ID: 941603872

View in Genome Browser
Species Human (GRCh38)
Location 2:167571541-167571563
Sequence CCCTCTGTGTGAGGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941603872_941603878 9 Left 941603872 2:167571541-167571563 CCCATAGCACCTCACACAGAGGG No data
Right 941603878 2:167571573-167571595 AGTTCCCTCCAGAAACACATGGG No data
941603872_941603877 8 Left 941603872 2:167571541-167571563 CCCATAGCACCTCACACAGAGGG No data
Right 941603877 2:167571572-167571594 GAGTTCCCTCCAGAAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941603872 Original CRISPR CCCTCTGTGTGAGGTGCTAT GGG (reversed) Intergenic
No off target data available for this crispr