ID: 941615513

View in Genome Browser
Species Human (GRCh38)
Location 2:167714110-167714132
Sequence CCTTGTTTGGATAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 5, 2: 5, 3: 10, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941615513_941615517 4 Left 941615513 2:167714110-167714132 CCATCCATTTTATCCAAACAAGG 0: 1
1: 5
2: 5
3: 10
4: 163
Right 941615517 2:167714137-167714159 TTAAAACTTCTGAGTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941615513 Original CRISPR CCTTGTTTGGATAAAATGGA TGG (reversed) Intergenic
900255900 1:1698139-1698161 CCTTGTTAGGACAACAGGGACGG + Intronic
900264568 1:1750749-1750771 CCTTGTTAGGACAACAGGGACGG + Intergenic
904563869 1:31415570-31415592 CTTTGTGAGGATTAAATGGAAGG - Intronic
910680889 1:89863276-89863298 CATTGGTTGGATAAAATAAAGGG + Intronic
913609474 1:120496178-120496200 CCTGATTTGAATAAAATTGAAGG + Intergenic
913985985 1:143566510-143566532 CCTGATTTGAATAAAATTGAAGG - Intergenic
914204349 1:145514338-145514360 CCTGATTTGAATAAAATTGAAGG - Intergenic
914483471 1:148087526-148087548 CCTGATTTGAATAAAATTGAAGG - Intergenic
914581716 1:149025661-149025683 CCTGATTTGAATAAAATTGAAGG - Intronic
915811001 1:158910285-158910307 CTTTGTTTGGAGAAAAAGTAAGG + Intergenic
916216683 1:162401251-162401273 TCTTGTGTGGACAAAATAGAGGG - Intronic
916907868 1:169308219-169308241 CATTGTCAGGGTAAAATGGAGGG + Intronic
916953124 1:169801734-169801756 CCTTTTTTGTTTTAAATGGAGGG + Intronic
917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG + Intergenic
919717425 1:200793562-200793584 CCTTGTTTGGATATTACTGATGG + Intronic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
924627319 1:245706348-245706370 CCTTCTTTGGATAGAAGGCAAGG + Intronic
1064676511 10:17765449-17765471 CCTTGTTTGGATGATTTTGAGGG - Intronic
1070358343 10:75662419-75662441 CACTGTTTAGATGAAATGGAAGG - Intronic
1072868935 10:99095925-99095947 CTTTGCTTGTATACAATGGACGG + Intronic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1076391664 10:130107975-130107997 CCTCCTTTGGATAAAATGGATGG + Intergenic
1078952329 11:16148242-16148264 CATTGTTTGAATAATATGGGAGG + Intronic
1081248066 11:40794540-40794562 CTTTCCTTGGATACAATGGAGGG + Intronic
1081515727 11:43826862-43826884 CCTGGTTTGGAGAAATTAGATGG - Intronic
1088461439 11:110087565-110087587 CATTGTTTGGTGAAAAGGGAAGG - Intergenic
1089414166 11:118273023-118273045 CCTTCTTGGGCTAAAATAGAGGG - Intergenic
1090897674 11:130993071-130993093 CTTTGTTTGGAAAAAAGAGACGG - Intergenic
1091794343 12:3288878-3288900 AATTGTTTGCATCAAATGGATGG + Intergenic
1091807978 12:3369605-3369627 CCTTATTTGGAAAAATAGGAGGG + Intergenic
1092482194 12:8869994-8870016 TCTTGTTTTGTTAAAATGAAAGG - Intronic
1093407170 12:18818678-18818700 CCTTGGATGAATAAGATGGAAGG - Intergenic
1094107228 12:26826980-26827002 CCTAGTATAGAAAAAATGGAAGG + Intronic
1094218816 12:27971875-27971897 ACTTGTTTGGATAGTATGAAAGG + Intronic
1095450780 12:42328424-42328446 CTTTTTTAGGGTAAAATGGAGGG + Intronic
1096897800 12:54841140-54841162 CCATGTTGCCATAAAATGGAAGG + Intronic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1099816830 12:87659567-87659589 TTTTGCTTGGAAAAAATGGATGG - Intergenic
1100068740 12:90683898-90683920 ACTTGTGTGGATAAAATAAAGGG + Intergenic
1101684079 12:106999756-106999778 CCACGCTTTGATAAAATGGAAGG - Exonic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1107692057 13:42963080-42963102 CCTTTGAAGGATAAAATGGAAGG + Intronic
1108371042 13:49768923-49768945 CCTTATTTGCATGAAATGTAAGG - Intronic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1109127019 13:58530552-58530574 CCTCCTTTGGATAAAATGGATGG + Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1111651704 13:91099065-91099087 CCTTTCTTTGATAAAATGGAAGG + Intergenic
1112235677 13:97634226-97634248 CCTTGTTAGTATGAACTGGAGGG - Intergenic
1116705939 14:48300325-48300347 CATATTTTGGTTAAAATGGAAGG + Intergenic
1117213010 14:53520948-53520970 CCTAGTATGGATCAAATTGAAGG - Intergenic
1120391411 14:83913071-83913093 CCTTATGGGAATAAAATGGAGGG - Intergenic
1120715822 14:87839864-87839886 CCTGGTTTGGATAAAATATATGG + Intronic
1121723743 14:96130844-96130866 CCTAGTTTGGATAAATTATATGG - Intergenic
1127003691 15:54541113-54541135 CCTTCTCTGGATAAAGAGGAAGG - Intronic
1128465523 15:67907667-67907689 CATTGGTTGGCCAAAATGGAGGG + Intergenic
1128854447 15:70996345-70996367 CCTTGTTTAGATAAAATGCAAGG - Intronic
1130178872 15:81605478-81605500 GGTTGTGTGTATAAAATGGATGG - Intergenic
1138254569 16:55543955-55543977 CCTTTTTAAGATAAAATGTATGG - Intronic
1139047755 16:63083788-63083810 CAGGGTTTGGATAAAAAGGAAGG - Intergenic
1146011178 17:29196069-29196091 CCTGGTGTGGCTAGAATGGAGGG + Intergenic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1149330436 17:55575950-55575972 CTTTGTTTTGATCAATTGGAGGG - Intergenic
1150456724 17:65312294-65312316 CCGTGTTTGGATAAACTATAGGG - Intergenic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1150836032 17:68565027-68565049 CCTTGTTTTGAGGAAATAGAAGG + Intronic
1151032162 17:70754138-70754160 CTTTCTTTTGATGAAATGGATGG - Intergenic
1153152038 18:2106637-2106659 CCTAAGTTGGGTAAAATGGAAGG - Intergenic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1156234609 18:35190057-35190079 CCGTATTTACATAAAATGGATGG + Intergenic
1158193389 18:54856577-54856599 CCTGCTTTGGATAAACTGCATGG - Intronic
1161819383 19:6520157-6520179 TCTTGTTTGGGCAAAAAGGAAGG - Intergenic
1164486981 19:28666922-28666944 CCTTATGGGGACAAAATGGAAGG - Intergenic
925821572 2:7804510-7804532 TCTTGTTTGAGTAAAATGCAAGG - Intergenic
925899319 2:8496989-8497011 TCTTGATGGGATAAAGTGGAAGG - Intergenic
925930998 2:8707841-8707863 CCTTGATTGACTAAAATTGAGGG - Intergenic
929864927 2:45709697-45709719 ACTCTTTTGAATAAAATGGAAGG + Intronic
935568809 2:104637303-104637325 CCATGTTTAGACAAAATGAATGG + Intergenic
936735902 2:115442942-115442964 CATGGTCTGGATAAAAAGGAAGG + Intronic
937217277 2:120320913-120320935 CCTTGTTTGTGATAAATGGAAGG + Intergenic
939146980 2:138426991-138427013 CCTATTTTGAATAAAATGGAGGG - Intergenic
939716582 2:145591406-145591428 TCTGTTTTGGATAAAATGCAAGG - Intergenic
940229676 2:151437270-151437292 GCATGTTTGGAAAAAAAGGAAGG - Exonic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
942166918 2:173250450-173250472 CCTTGTTTTTACAAACTGGAAGG + Intronic
944968474 2:204963249-204963271 TCTTATGTGGATAAAATGTATGG + Intronic
945647805 2:212522221-212522243 CCTTGTTTGTAAAATAAGGATGG + Intronic
946554831 2:220844423-220844445 CATTGTTTGCATAAAACAGATGG + Intergenic
948024534 2:234766563-234766585 CCTTGTTTGGATTAGTTTGATGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170034989 20:11980779-11980801 CCTTGTTTGGCTAAACCAGAAGG + Intergenic
1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG + Intergenic
1174815782 20:53685790-53685812 TCTTGTTTGTTTAAAATAGATGG - Intergenic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175321531 20:58091756-58091778 CCTCTTTAGCATAAAATGGATGG - Intergenic
1175387443 20:58606220-58606242 CCTTGTTTGGCTCAAATGTGGGG - Intergenic
1180593025 22:16956669-16956691 CCTTCCTTGGGTAAAAGGGAGGG - Intergenic
1181561104 22:23701089-23701111 CCTTTTTTGGAAAATATGGTAGG - Intergenic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1184318298 22:43717050-43717072 ACTTGTTTGGTAAAAAAGGAAGG + Intronic
949720056 3:6978487-6978509 AATTGTTTGGATCAAATGGGGGG - Intronic
952745862 3:36778261-36778283 CCTGGTTTGGATAAATTATAAGG + Intergenic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
957607239 3:82417199-82417221 CCTTGGTTGTACAAAATGAATGG + Intergenic
960064904 3:113361115-113361137 CCTTGGGTGGATTTAATGGAAGG + Intronic
960639494 3:119812412-119812434 CCCTGCTTGGTTAAAATGGAGGG - Intronic
960720106 3:120617266-120617288 GCTTGTCTGGATAAGGTGGAGGG + Intergenic
961036839 3:123648400-123648422 ACTTCTGTGGATCAAATGGAAGG + Intronic
961075567 3:123978764-123978786 TCATGTCTGGATAGAATGGAGGG + Intronic
961308120 3:125973744-125973766 TCATGTCTGGATAGAATGGAGGG - Intronic
961440475 3:126949733-126949755 GCTTGCTTGGATAGAAGGGAAGG + Intronic
962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG + Intergenic
963655325 3:148041539-148041561 CCTACTTTGGATGAAATGAAAGG - Intergenic
966031341 3:175351921-175351943 GCTGGTTTGGATAAAATGACTGG - Intronic
966707838 3:182936075-182936097 CCTTGTAAGGGTAAAATAGAGGG - Intergenic
973057329 4:45677817-45677839 CCATTTTGGGACAAAATGGATGG - Intergenic
974842497 4:67314027-67314049 CAGAGTTTGGATAAAAAGGAAGG + Intergenic
975715732 4:77204007-77204029 CCTTGTGTGGAAGGAATGGAGGG - Intronic
977346492 4:95822917-95822939 CATTGTTTGGCCAAAATTGAGGG + Intergenic
983133040 4:164045266-164045288 CTTTGGTAGGATAAAGTGGATGG + Intronic
985118676 4:186617346-186617368 CCTTGTTTTTGTAAATTGGAAGG - Intronic
987960362 5:24799418-24799440 CCTTGTTTTATTACAATGGATGG + Intergenic
989606717 5:43251459-43251481 CCTCGTTTGTAAAACATGGAAGG - Intronic
993354206 5:86885530-86885552 CCTTCTGTGGATGAAATGTATGG + Intergenic
993836076 5:92822112-92822134 GCTGGTTTGGATAAAATGACGGG + Intergenic
997641915 5:135454997-135455019 CCTGGGTTGGGTAAAATTGAAGG + Intergenic
999568601 5:152893213-152893235 CCTTGTTTGGTCCAAATGGAAGG + Intergenic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004266790 6:14155137-14155159 CCTTGTTTTTAAAAAATTGATGG + Intergenic
1004666434 6:17752365-17752387 TCTTGTTTTGACAGAATGGAAGG + Intergenic
1006414792 6:33897022-33897044 CCTTGTTTGTTTAAAATGTCAGG + Intergenic
1006604156 6:35244216-35244238 ACTGGTTTGGAGAAAATGGTGGG - Intronic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1008138367 6:47803101-47803123 CATTCTGTGGATAAAATAGAAGG + Intronic
1010035592 6:71321909-71321931 CCTTCCTTAAATAAAATGGATGG - Intergenic
1012499597 6:99874370-99874392 CCTTGTTTGGATCTCATGAAGGG + Intergenic
1012532794 6:100258697-100258719 CCTTTTTTGGTTAATATTGAGGG + Intergenic
1014236930 6:118968488-118968510 CCATATTGGGATAAAATGCAAGG - Intronic
1014879685 6:126708051-126708073 CCTTGGTTGGATAACATATAGGG + Intergenic
1014939311 6:127419553-127419575 CCTTGTTTTGAAAATAGGGAAGG - Intergenic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1021294131 7:18882860-18882882 TCCTGTTTGAAGAAAATGGAAGG + Intronic
1021474450 7:21044589-21044611 GCTTGTTTGAATAAAAGAGAAGG + Intergenic
1022603162 7:31781045-31781067 CCTTGTTTGGTTCAACTAGAGGG + Intronic
1023715411 7:43038915-43038937 GCTTGTTTGGATAAGTTTGATGG - Intergenic
1024389353 7:48789352-48789374 CATTTTGTGGAAAAAATGGATGG + Intergenic
1026185652 7:68080920-68080942 CCTTCTTTTGAAAATATGGAGGG - Intergenic
1027582351 7:80014514-80014536 CCATGTTTTGATCAAGTGGATGG - Intergenic
1028268382 7:88757464-88757486 CCATATTTTTATAAAATGGAAGG - Intergenic
1032948247 7:136876539-136876561 CTTTGATACGATAAAATGGAGGG - Intronic
1033678971 7:143573759-143573781 ACTTCTTTGGATAAAATGGATGG + Exonic
1033692867 7:143755695-143755717 ACTTCTTTGGATAAAATGGATGG - Exonic
1036132014 8:6124294-6124316 CTGTGTGTGGATAAAAGGGAAGG + Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1039341486 8:36655233-36655255 TCTGTTTTGGATAAAATAGATGG + Intergenic
1040004459 8:42607802-42607824 CATTGTTTGGATAAAAGAGATGG + Intergenic
1041966350 8:63682790-63682812 CCTTGGTTTGATTAAATGAAGGG + Intergenic
1042762941 8:72290565-72290587 CCTTCTTAGGATAGAAGGGAGGG - Intergenic
1043111350 8:76186916-76186938 CCATCTTGTGATAAAATGGAAGG - Intergenic
1044370534 8:91404998-91405020 CCTTGATTAGAAAAAAAGGACGG - Intergenic
1044935073 8:97286105-97286127 CCTTGTGTGGTTAAAGAGGAAGG + Intergenic
1045108348 8:98915823-98915845 CCATGTTGGCATAAAAAGGAAGG - Intronic
1047268632 8:123332948-123332970 CCTTCTTTTGAAAAAATGGGAGG - Intronic
1049805157 8:144535465-144535487 CCTTGTTTTTCTAGAATGGATGG + Intronic
1051541691 9:18227105-18227127 TTTTGTTAGGAAAAAATGGAGGG - Intergenic
1052365599 9:27608839-27608861 ACTTCTTTGGATAAAGTGGATGG - Intergenic
1054937849 9:70708301-70708323 CCTTGTTTGAATAAAAAGCTTGG - Intronic
1054939540 9:70726294-70726316 CCTTGTTTGAATAAAAAGCTTGG - Intronic
1056940362 9:90950253-90950275 CCTTCTTTTGACAAAATGAAAGG - Intergenic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1185964380 X:4584067-4584089 CTTTGTCTGGATAAAGTTGATGG - Intergenic
1186510617 X:10127283-10127305 TCTTGTTTGGTTAAGATTGAAGG + Intronic
1186917759 X:14242141-14242163 CCTTGGTTGGAAAAAAAGGGGGG - Intergenic
1188861210 X:35258992-35259014 CATTGGTTGGGGAAAATGGAAGG + Intergenic
1190557939 X:51655701-51655723 CTTTGTTTGTATAAATTGGTTGG + Intergenic
1191785978 X:64917505-64917527 CCTTGTTTGGAGCTAAGGGAAGG - Exonic
1193648935 X:84106692-84106714 CCTCTTTTGAATAAAATAGAAGG - Intronic
1194044171 X:88981812-88981834 CCTTGTTTGTATATAATGCTAGG + Intergenic
1194461567 X:94176085-94176107 CCTTGATTGAATAAAAAGGGAGG + Intergenic
1195662126 X:107389398-107389420 CCCTGATTTGAGAAAATGGATGG + Intergenic
1198502144 X:137260824-137260846 TCTTGTTTGGAGAAAATAGTCGG - Intergenic
1199676914 X:150196781-150196803 CCTTATTTGGAAAAAAAAGAGGG + Intergenic
1201342816 Y:12952600-12952622 CGTTTGTTGGATAAGATGGAGGG - Intergenic