ID: 941621576

View in Genome Browser
Species Human (GRCh38)
Location 2:167785008-167785030
Sequence AGATGTACACGGCAGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941621576_941621583 29 Left 941621576 2:167785008-167785030 CCACTCATCTGCCGTGTACATCT No data
Right 941621583 2:167785060-167785082 GTGACCCTGGAGAAGTCAGTAGG No data
941621576_941621578 -8 Left 941621576 2:167785008-167785030 CCACTCATCTGCCGTGTACATCT No data
Right 941621578 2:167785023-167785045 GTACATCTGACCTATACCACAGG No data
941621576_941621580 7 Left 941621576 2:167785008-167785030 CCACTCATCTGCCGTGTACATCT No data
Right 941621580 2:167785038-167785060 ACCACAGGATCAACACAAATTGG No data
941621576_941621582 16 Left 941621576 2:167785008-167785030 CCACTCATCTGCCGTGTACATCT No data
Right 941621582 2:167785047-167785069 TCAACACAAATTGGTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941621576 Original CRISPR AGATGTACACGGCAGATGAG TGG (reversed) Intergenic
No off target data available for this crispr