ID: 941624475

View in Genome Browser
Species Human (GRCh38)
Location 2:167815623-167815645
Sequence CATAGCTAGCACTCATAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941624471_941624475 26 Left 941624471 2:167815574-167815596 CCAAATATTATTACTGTCTTGTT No data
Right 941624475 2:167815623-167815645 CATAGCTAGCACTCATAAGTCGG No data
941624472_941624475 0 Left 941624472 2:167815600-167815622 CCTATTATGTCACTAAATTCTCC No data
Right 941624475 2:167815623-167815645 CATAGCTAGCACTCATAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941624475 Original CRISPR CATAGCTAGCACTCATAAGT CGG Intergenic
No off target data available for this crispr