ID: 941626081

View in Genome Browser
Species Human (GRCh38)
Location 2:167831820-167831842
Sequence AAACTGCAACATATGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941626075_941626081 26 Left 941626075 2:167831771-167831793 CCTGTCTCAGGAAGAGCCCATCA No data
Right 941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG No data
941626078_941626081 9 Left 941626078 2:167831788-167831810 CCATCACTGGTGACAGCTATTTG No data
Right 941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG No data
941626077_941626081 10 Left 941626077 2:167831787-167831809 CCCATCACTGGTGACAGCTATTT No data
Right 941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941626081 Original CRISPR AAACTGCAACATATGTAGAG AGG Intergenic
No off target data available for this crispr