ID: 941626261

View in Genome Browser
Species Human (GRCh38)
Location 2:167833925-167833947
Sequence ACTTCCAACGCTGAAATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941626260_941626261 -3 Left 941626260 2:167833905-167833927 CCTAAATTATCTCTAAGACTACT No data
Right 941626261 2:167833925-167833947 ACTTCCAACGCTGAAATTTGAGG No data
941626259_941626261 15 Left 941626259 2:167833887-167833909 CCTAGAGTAGATAATTTTCCTAA No data
Right 941626261 2:167833925-167833947 ACTTCCAACGCTGAAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941626261 Original CRISPR ACTTCCAACGCTGAAATTTG AGG Intergenic
No off target data available for this crispr