ID: 941629121

View in Genome Browser
Species Human (GRCh38)
Location 2:167865052-167865074
Sequence CTGCATAAACATAGGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941629121_941629126 2 Left 941629121 2:167865052-167865074 CCCAGCTACCTATGTTTATGCAG No data
Right 941629126 2:167865077-167865099 CCTTCCCCCAGAAAATCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941629121 Original CRISPR CTGCATAAACATAGGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr