ID: 941637208

View in Genome Browser
Species Human (GRCh38)
Location 2:167947505-167947527
Sequence GGTAATGTAGGAAAAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941637205_941637208 5 Left 941637205 2:167947477-167947499 CCTAAAGTTGTTGGAAAGGCTTA No data
Right 941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG No data
941637203_941637208 12 Left 941637203 2:167947470-167947492 CCAGTTTCCTAAAGTTGTTGGAA No data
Right 941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941637208 Original CRISPR GGTAATGTAGGAAAAGCTTT TGG Intergenic
No off target data available for this crispr