ID: 941638463

View in Genome Browser
Species Human (GRCh38)
Location 2:167961688-167961710
Sequence TTCCATTGTTGGTATGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941638463_941638470 16 Left 941638463 2:167961688-167961710 CCCTGGCCATACCAACAATGGAA No data
Right 941638470 2:167961727-167961749 TCCCTGTGGAATGCTTCTCAGGG No data
941638463_941638468 2 Left 941638463 2:167961688-167961710 CCCTGGCCATACCAACAATGGAA No data
Right 941638468 2:167961713-167961735 CCTACTTATTATCTTCCCTGTGG No data
941638463_941638469 15 Left 941638463 2:167961688-167961710 CCCTGGCCATACCAACAATGGAA No data
Right 941638469 2:167961726-167961748 TTCCCTGTGGAATGCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941638463 Original CRISPR TTCCATTGTTGGTATGGCCA GGG (reversed) Intronic
No off target data available for this crispr