ID: 941641389

View in Genome Browser
Species Human (GRCh38)
Location 2:167992438-167992460
Sequence CAGAGCAGAAAGAAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941641381_941641389 24 Left 941641381 2:167992391-167992413 CCTCTGCACTATAGCAAAAACCT No data
Right 941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG No data
941641383_941641389 4 Left 941641383 2:167992411-167992433 CCTGAAGAAACTGTCTGGAACTG No data
Right 941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941641389 Original CRISPR CAGAGCAGAAAGAAGGATGT GGG Intronic
No off target data available for this crispr