ID: 941644245

View in Genome Browser
Species Human (GRCh38)
Location 2:168023436-168023458
Sequence CTGCACCTCCACCACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941644245_941644250 11 Left 941644245 2:168023436-168023458 CCTTCCCAGTGGTGGAGGTGCAG No data
Right 941644250 2:168023470-168023492 GATTGAAGTATATATTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941644245 Original CRISPR CTGCACCTCCACCACTGGGA AGG (reversed) Intronic
No off target data available for this crispr