ID: 941645222

View in Genome Browser
Species Human (GRCh38)
Location 2:168033057-168033079
Sequence TATGTTGGCAGACCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941645222_941645227 22 Left 941645222 2:168033057-168033079 CCTGGCACAGGTCTGCCAACATA No data
Right 941645227 2:168033102-168033124 ATGAAGTTGAACTGAATCAAGGG No data
941645222_941645226 21 Left 941645222 2:168033057-168033079 CCTGGCACAGGTCTGCCAACATA No data
Right 941645226 2:168033101-168033123 CATGAAGTTGAACTGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941645222 Original CRISPR TATGTTGGCAGACCTGTGCC AGG (reversed) Intronic
No off target data available for this crispr