ID: 941650889

View in Genome Browser
Species Human (GRCh38)
Location 2:168091465-168091487
Sequence CAGGACTTGGGGCAGCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941650889_941650897 17 Left 941650889 2:168091465-168091487 CCAGAAAGCTGCCCCAAGTCCTG No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941650889 Original CRISPR CAGGACTTGGGGCAGCTTTC TGG (reversed) Intronic
No off target data available for this crispr