ID: 941650889 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:168091465-168091487 |
| Sequence | CAGGACTTGGGGCAGCTTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941650889_941650897 | 17 | Left | 941650889 | 2:168091465-168091487 | CCAGAAAGCTGCCCCAAGTCCTG | No data | ||
| Right | 941650897 | 2:168091505-168091527 | TCACACAAACTGTTTAGCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941650889 | Original CRISPR | CAGGACTTGGGGCAGCTTTC TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||