ID: 941650897

View in Genome Browser
Species Human (GRCh38)
Location 2:168091505-168091527
Sequence TCACACAAACTGTTTAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941650889_941650897 17 Left 941650889 2:168091465-168091487 CCAGAAAGCTGCCCCAAGTCCTG No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data
941650894_941650897 5 Left 941650894 2:168091477-168091499 CCCAAGTCCTGGTGGGACAGTGT No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data
941650893_941650897 6 Left 941650893 2:168091476-168091498 CCCCAAGTCCTGGTGGGACAGTG No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data
941650896_941650897 -2 Left 941650896 2:168091484-168091506 CCTGGTGGGACAGTGTTGTCATC No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data
941650895_941650897 4 Left 941650895 2:168091478-168091500 CCAAGTCCTGGTGGGACAGTGTT No data
Right 941650897 2:168091505-168091527 TCACACAAACTGTTTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941650897 Original CRISPR TCACACAAACTGTTTAGCTG TGG Intronic
No off target data available for this crispr