ID: 941652056

View in Genome Browser
Species Human (GRCh38)
Location 2:168102436-168102458
Sequence TGTTGGGTATACAAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941652052_941652056 -9 Left 941652052 2:168102422-168102444 CCAATCCGTATTCCTGTTGGGTA No data
Right 941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG No data
941652049_941652056 17 Left 941652049 2:168102396-168102418 CCTTGCATGATCTTATGAGGTAA No data
Right 941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG No data
941652046_941652056 21 Left 941652046 2:168102392-168102414 CCTCCCTTGCATGATCTTATGAG No data
Right 941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG No data
941652048_941652056 18 Left 941652048 2:168102395-168102417 CCCTTGCATGATCTTATGAGGTA No data
Right 941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG No data
941652045_941652056 22 Left 941652045 2:168102391-168102413 CCCTCCCTTGCATGATCTTATGA No data
Right 941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941652056 Original CRISPR TGTTGGGTATACAAGGAAAC TGG Intronic
No off target data available for this crispr