ID: 941653534

View in Genome Browser
Species Human (GRCh38)
Location 2:168119122-168119144
Sequence CATGGTCGGTTTTAAGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941653523_941653534 29 Left 941653523 2:168119070-168119092 CCCTCCTCCCTGTGAGCATGTGA No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data
941653527_941653534 21 Left 941653527 2:168119078-168119100 CCTGTGAGCATGTGAGTTCCTCA No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data
941653524_941653534 28 Left 941653524 2:168119071-168119093 CCTCCTCCCTGTGAGCATGTGAG No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data
941653528_941653534 3 Left 941653528 2:168119096-168119118 CCTCAATGAGATTTATTCCCAAG No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data
941653526_941653534 22 Left 941653526 2:168119077-168119099 CCCTGTGAGCATGTGAGTTCCTC No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data
941653525_941653534 25 Left 941653525 2:168119074-168119096 CCTCCCTGTGAGCATGTGAGTTC No data
Right 941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941653534 Original CRISPR CATGGTCGGTTTTAAGCGAG AGG Intronic
No off target data available for this crispr