ID: 941654325

View in Genome Browser
Species Human (GRCh38)
Location 2:168126963-168126985
Sequence GCATTTGAAGGGATGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941654318_941654325 8 Left 941654318 2:168126932-168126954 CCTATGTGACACTGAGCTGTGCG No data
Right 941654325 2:168126963-168126985 GCATTTGAAGGGATGGATGATGG No data
941654316_941654325 17 Left 941654316 2:168126923-168126945 CCCTTCACTCCTATGTGACACTG No data
Right 941654325 2:168126963-168126985 GCATTTGAAGGGATGGATGATGG No data
941654317_941654325 16 Left 941654317 2:168126924-168126946 CCTTCACTCCTATGTGACACTGA No data
Right 941654325 2:168126963-168126985 GCATTTGAAGGGATGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941654325 Original CRISPR GCATTTGAAGGGATGGATGA TGG Intronic
No off target data available for this crispr