ID: 941654325 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:168126963-168126985 |
| Sequence | GCATTTGAAGGGATGGATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941654318_941654325 | 8 | Left | 941654318 | 2:168126932-168126954 | CCTATGTGACACTGAGCTGTGCG | No data | ||
| Right | 941654325 | 2:168126963-168126985 | GCATTTGAAGGGATGGATGATGG | No data | ||||
| 941654316_941654325 | 17 | Left | 941654316 | 2:168126923-168126945 | CCCTTCACTCCTATGTGACACTG | No data | ||
| Right | 941654325 | 2:168126963-168126985 | GCATTTGAAGGGATGGATGATGG | No data | ||||
| 941654317_941654325 | 16 | Left | 941654317 | 2:168126924-168126946 | CCTTCACTCCTATGTGACACTGA | No data | ||
| Right | 941654325 | 2:168126963-168126985 | GCATTTGAAGGGATGGATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941654325 | Original CRISPR | GCATTTGAAGGGATGGATGA TGG | Intronic | ||
| No off target data available for this crispr | |||||