ID: 941656154

View in Genome Browser
Species Human (GRCh38)
Location 2:168146820-168146842
Sequence CTGTATATGAATAGAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941656151_941656154 -1 Left 941656151 2:168146798-168146820 CCAGGAGCAAAATCAACAGAGCC No data
Right 941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG No data
941656150_941656154 0 Left 941656150 2:168146797-168146819 CCCAGGAGCAAAATCAACAGAGC No data
Right 941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG No data
941656149_941656154 6 Left 941656149 2:168146791-168146813 CCATAGCCCAGGAGCAAAATCAA No data
Right 941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG No data
941656148_941656154 12 Left 941656148 2:168146785-168146807 CCACAACCATAGCCCAGGAGCAA No data
Right 941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941656154 Original CRISPR CTGTATATGAATAGAGAGGT TGG Intronic
No off target data available for this crispr