ID: 941657516

View in Genome Browser
Species Human (GRCh38)
Location 2:168159889-168159911
Sequence AGGCAGGAAGCCCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941657516_941657525 23 Left 941657516 2:168159889-168159911 CCCTGTGCAGGGGCTTCCTGCCT No data
Right 941657525 2:168159935-168159957 CGCACAGTGCAGGCACGTACTGG No data
941657516_941657522 13 Left 941657516 2:168159889-168159911 CCCTGTGCAGGGGCTTCCTGCCT No data
Right 941657522 2:168159925-168159947 CTCAGCAGCCCGCACAGTGCAGG No data
941657516_941657526 24 Left 941657516 2:168159889-168159911 CCCTGTGCAGGGGCTTCCTGCCT No data
Right 941657526 2:168159936-168159958 GCACAGTGCAGGCACGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941657516 Original CRISPR AGGCAGGAAGCCCCTGCACA GGG (reversed) Intronic
No off target data available for this crispr