ID: 941658985

View in Genome Browser
Species Human (GRCh38)
Location 2:168175096-168175118
Sequence CTGTGGAATCCTCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941658985_941658992 12 Left 941658985 2:168175096-168175118 CCTTCCTCCTGAGGATTCCACAG No data
Right 941658992 2:168175131-168175153 AGCAACAGCTTAATTAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941658985 Original CRISPR CTGTGGAATCCTCAGGAGGA AGG (reversed) Intronic
No off target data available for this crispr