ID: 941658985 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:168175096-168175118 |
| Sequence | CTGTGGAATCCTCAGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941658985_941658992 | 12 | Left | 941658985 | 2:168175096-168175118 | CCTTCCTCCTGAGGATTCCACAG | No data | ||
| Right | 941658992 | 2:168175131-168175153 | AGCAACAGCTTAATTAATTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941658985 | Original CRISPR | CTGTGGAATCCTCAGGAGGA AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||