ID: 941660226

View in Genome Browser
Species Human (GRCh38)
Location 2:168188940-168188962
Sequence TTCTCAAGGCAGCTACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941660223_941660226 -3 Left 941660223 2:168188920-168188942 CCAGTGCAGCAAGACCATGTTTC No data
Right 941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG No data
941660222_941660226 -2 Left 941660222 2:168188919-168188941 CCCAGTGCAGCAAGACCATGTTT No data
Right 941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG No data
941660220_941660226 9 Left 941660220 2:168188908-168188930 CCTCCACTGAGCCCAGTGCAGCA No data
Right 941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG No data
941660221_941660226 6 Left 941660221 2:168188911-168188933 CCACTGAGCCCAGTGCAGCAAGA No data
Right 941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG No data
941660219_941660226 16 Left 941660219 2:168188901-168188923 CCGCTCGCCTCCACTGAGCCCAG No data
Right 941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941660226 Original CRISPR TTCTCAAGGCAGCTACAAAC TGG Intronic
No off target data available for this crispr