ID: 941661781

View in Genome Browser
Species Human (GRCh38)
Location 2:168202869-168202891
Sequence TTGTTGCTCTTAAGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941661781_941661785 -8 Left 941661781 2:168202869-168202891 CCATTTGCCCTTAAGAGCAACAA No data
Right 941661785 2:168202884-168202906 AGCAACAAACGGAAGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941661781 Original CRISPR TTGTTGCTCTTAAGGGCAAA TGG (reversed) Intronic
No off target data available for this crispr