ID: 941663178

View in Genome Browser
Species Human (GRCh38)
Location 2:168216250-168216272
Sequence AATCAGAGGGAGACAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941663172_941663178 14 Left 941663172 2:168216213-168216235 CCTGACCAGAGGTACATGGAAGG No data
Right 941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG No data
941663174_941663178 9 Left 941663174 2:168216218-168216240 CCAGAGGTACATGGAAGGTAAGG No data
Right 941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941663178 Original CRISPR AATCAGAGGGAGACAGATGA AGG Intronic
No off target data available for this crispr