ID: 941663604

View in Genome Browser
Species Human (GRCh38)
Location 2:168220855-168220877
Sequence AAATCTAGGCTGCATTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941663598_941663604 8 Left 941663598 2:168220824-168220846 CCTCACTTTCAGTTAAATACCAC No data
Right 941663604 2:168220855-168220877 AAATCTAGGCTGCATTGCAGGGG No data
941663597_941663604 9 Left 941663597 2:168220823-168220845 CCCTCACTTTCAGTTAAATACCA No data
Right 941663604 2:168220855-168220877 AAATCTAGGCTGCATTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941663604 Original CRISPR AAATCTAGGCTGCATTGCAG GGG Intronic