ID: 941663604 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:168220855-168220877 |
| Sequence | AAATCTAGGCTGCATTGCAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941663598_941663604 | 8 | Left | 941663598 | 2:168220824-168220846 | CCTCACTTTCAGTTAAATACCAC | No data | ||
| Right | 941663604 | 2:168220855-168220877 | AAATCTAGGCTGCATTGCAGGGG | No data | ||||
| 941663597_941663604 | 9 | Left | 941663597 | 2:168220823-168220845 | CCCTCACTTTCAGTTAAATACCA | No data | ||
| Right | 941663604 | 2:168220855-168220877 | AAATCTAGGCTGCATTGCAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941663604 | Original CRISPR | AAATCTAGGCTGCATTGCAG GGG | Intronic | ||