ID: 941668156

View in Genome Browser
Species Human (GRCh38)
Location 2:168262088-168262110
Sequence GAGGAATGGTGCCATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941668156_941668167 16 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668167 2:168262127-168262149 TACCTGGTTGGAAAGGGCAGAGG No data
941668156_941668162 0 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668162 2:168262111-168262133 GAGGTGATCAGCCAGCTACCTGG No data
941668156_941668164 9 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668164 2:168262120-168262142 AGCCAGCTACCTGGTTGGAAAGG No data
941668156_941668165 10 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668165 2:168262121-168262143 GCCAGCTACCTGGTTGGAAAGGG No data
941668156_941668163 4 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668163 2:168262115-168262137 TGATCAGCCAGCTACCTGGTTGG No data
941668156_941668169 30 Left 941668156 2:168262088-168262110 CCCTCCACATGGCACCATTCCTC No data
Right 941668169 2:168262141-168262163 GGGCAGAGGTTTGTCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941668156 Original CRISPR GAGGAATGGTGCCATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr