ID: 941670099

View in Genome Browser
Species Human (GRCh38)
Location 2:168283946-168283968
Sequence TCTACCATGCTCAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941670093_941670099 16 Left 941670093 2:168283907-168283929 CCATTAAAGCAACCTAAATATTA No data
Right 941670099 2:168283946-168283968 TCTACCATGCTCAAGCTGGAGGG No data
941670095_941670099 4 Left 941670095 2:168283919-168283941 CCTAAATATTAGCAACATCAGGA No data
Right 941670099 2:168283946-168283968 TCTACCATGCTCAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941670099 Original CRISPR TCTACCATGCTCAAGCTGGA GGG Intergenic
No off target data available for this crispr