ID: 941674364

View in Genome Browser
Species Human (GRCh38)
Location 2:168328238-168328260
Sequence GCAATCTGCTGAACTGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941674362_941674364 6 Left 941674362 2:168328209-168328231 CCTAAAGCAAGAAAGGAGAAGAA No data
Right 941674364 2:168328238-168328260 GCAATCTGCTGAACTGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941674364 Original CRISPR GCAATCTGCTGAACTGGAAT TGG Intergenic
No off target data available for this crispr