ID: 941674428

View in Genome Browser
Species Human (GRCh38)
Location 2:168328692-168328714
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941674422_941674428 29 Left 941674422 2:168328640-168328662 CCCACAACTGAGATGTGAGTGAG No data
Right 941674428 2:168328692-168328714 GCAGGCACTGCTGGCATGAATGG No data
941674423_941674428 28 Left 941674423 2:168328641-168328663 CCACAACTGAGATGTGAGTGAGG No data
Right 941674428 2:168328692-168328714 GCAGGCACTGCTGGCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type