ID: 941676508

View in Genome Browser
Species Human (GRCh38)
Location 2:168348274-168348296
Sequence CAGGCAACTCCCACCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941676503_941676508 -1 Left 941676503 2:168348252-168348274 CCAAGCCTCTAGGTGGCCAAGCC No data
Right 941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG No data
941676500_941676508 14 Left 941676500 2:168348237-168348259 CCTGAGCATTCTAATCCAAGCCT No data
Right 941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG No data
941676498_941676508 20 Left 941676498 2:168348231-168348253 CCCTGGCCTGAGCATTCTAATCC No data
Right 941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG No data
941676505_941676508 -6 Left 941676505 2:168348257-168348279 CCTCTAGGTGGCCAAGCCAGGCA No data
Right 941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG No data
941676499_941676508 19 Left 941676499 2:168348232-168348254 CCTGGCCTGAGCATTCTAATCCA No data
Right 941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941676508 Original CRISPR CAGGCAACTCCCACCCTGAG TGG Intergenic
No off target data available for this crispr