ID: 941686628

View in Genome Browser
Species Human (GRCh38)
Location 2:168455246-168455268
Sequence AACCATGTATACATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 642}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941686622_941686628 22 Left 941686622 2:168455201-168455223 CCAGGCAGAAAATGAATGTGAGA 0: 1
1: 0
2: 3
3: 31
4: 341
Right 941686628 2:168455246-168455268 AACCATGTATACATGGGCCATGG 0: 1
1: 0
2: 1
3: 22
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941686628 Original CRISPR AACCATGTATACATGGGCCA TGG Intergenic
900372555 1:2338569-2338591 AACCATGTGTACTTGGGGCTCGG - Intronic
900816005 1:4846467-4846489 ACACAGGTATACATGTGCCATGG + Intergenic
901801549 1:11711225-11711247 AACCATGTATTCCTGGGAAATGG - Intronic
903277711 1:22232430-22232452 CACCATGTGTACATGTGTCATGG - Intergenic
903621108 1:24699065-24699087 AACTATTGATACATGGGCCAAGG - Intergenic
904583593 1:31565976-31565998 ACATAGGTATACATGGGCCATGG - Intergenic
904922126 1:34016199-34016221 ACACAGGTATACATGTGCCATGG + Intronic
906900382 1:49829679-49829701 ACACATTTATACATGTGCCACGG + Intronic
907553123 1:55320991-55321013 AGCTATGGATACATGGTCCATGG - Intergenic
907574571 1:55514533-55514555 ACACAGGTATACATGTGCCATGG + Intergenic
907998319 1:59655322-59655344 AAATAGGTATACATGTGCCATGG + Intronic
908789434 1:67767007-67767029 AACGATCTATCCATGGGTCAGGG - Intronic
909297417 1:73968362-73968384 ACATATGTATACATGTGCCATGG - Intergenic
909909545 1:81245074-81245096 ATATATGTATACATGTGCCATGG - Intergenic
911255835 1:95632213-95632235 ACACAGGTATACATGTGCCATGG - Intergenic
911292931 1:96080055-96080077 ACACAGGTATACATGTGCCATGG - Intergenic
911762267 1:101629866-101629888 ACATATGTATACATGTGCCATGG - Intergenic
912070610 1:105805028-105805050 ACATAGGTATACATGGGCCATGG - Intergenic
912278423 1:108286553-108286575 ACACAGGTATACATGTGCCATGG + Intergenic
912289803 1:108407804-108407826 ACACAGGTATACATGTGCCATGG - Intronic
915184754 1:154096007-154096029 ACCTAGGTATACATGCGCCATGG + Intronic
916625004 1:166546174-166546196 ACACAGGTATACATGTGCCATGG + Intergenic
916674008 1:167051096-167051118 ACATATGTATACATGTGCCATGG - Intergenic
916730198 1:167559422-167559444 ACATAGGTATACATGGGCCATGG + Intergenic
916888958 1:169097917-169097939 ACACAGGTATACATGTGCCATGG - Intergenic
917022755 1:170608300-170608322 ACACAGGTATACATGTGCCATGG + Intergenic
917138999 1:171815900-171815922 AAGTAGGTATACATGTGCCATGG - Intergenic
917715204 1:177728291-177728313 ACGTATGTATACATGTGCCATGG - Intergenic
919082350 1:192881475-192881497 ACACAGGTATACATGTGCCATGG - Intergenic
919171489 1:193959661-193959683 ACATATGTATACATGTGCCATGG - Intergenic
919186406 1:194157080-194157102 ACATAGGTATACATGGGCCATGG + Intergenic
919324899 1:196094654-196094676 ACACAGGTATACATGTGCCATGG - Intergenic
919368668 1:196698084-196698106 ACATATGTATACATGTGCCATGG - Intronic
919474304 1:198016064-198016086 ACACAGGTATACATGTGCCATGG + Intergenic
920753908 1:208708947-208708969 ACATATGTATACATGTGCCATGG - Intergenic
920968239 1:210719642-210719664 ACACAGGTATACATGTGCCATGG - Intronic
921296293 1:213706610-213706632 ACATATGTATACATGTGCCAGGG + Intergenic
922981248 1:229828933-229828955 ACCTAGGTATACATGTGCCACGG + Intergenic
923882446 1:238118476-238118498 ACACAGGTATACATGTGCCATGG + Intergenic
924299143 1:242619254-242619276 ACACAGGTATACATGTGCCATGG - Intergenic
924822563 1:247507584-247507606 AAGCATGTATACACGTGCCATGG + Intronic
924875958 1:248104983-248105005 ACATATGTATACATGTGCCATGG + Intergenic
1063076789 10:2724842-2724864 ACACAGGTATACATGTGCCATGG + Intergenic
1063099984 10:2941901-2941923 ACACAGGTATACATGTGCCATGG - Intergenic
1064849941 10:19699138-19699160 ACACAGGTATACATGTGCCATGG - Intronic
1064978250 10:21140888-21140910 ACCTAGGTATACATGCGCCATGG - Intronic
1065065644 10:21960835-21960857 ACATATGTATACATGTGCCACGG - Intronic
1065735381 10:28746670-28746692 ACATATGTATACATGTGCCACGG + Intergenic
1066754153 10:38692755-38692777 ACACAGGTATACATGTGCCATGG - Intergenic
1067897190 10:50196108-50196130 AAATATGTATACATGGGGAATGG - Intronic
1067946575 10:50693116-50693138 ACATAGGTATACATGGGCCATGG + Intergenic
1067951781 10:50745916-50745938 AAATATGTATACATGGGGAATGG + Intronic
1068408113 10:56619646-56619668 ACACAGGTATACATGTGCCATGG + Intergenic
1068576431 10:58688958-58688980 ACACAGGTATACATGTGCCATGG - Intronic
1069032341 10:63610508-63610530 ACACAGGTATACATGTGCCATGG - Intronic
1069423953 10:68273179-68273201 ACATAGGTATACATGGGCCATGG - Intergenic
1069436178 10:68385665-68385687 ACACAGGTATACATGTGCCATGG + Intronic
1070829793 10:79411373-79411395 AACCATGTGAACACAGGCCACGG + Intronic
1070881889 10:79858117-79858139 ACATAGGTATACATGGGCCATGG + Intergenic
1071046047 10:81378717-81378739 ACATATGTATACATGTGCCATGG - Intergenic
1071648466 10:87374431-87374453 ACATAGGTATACATGGGCCATGG + Intergenic
1073941125 10:108699713-108699735 ACACAGGTATACATGTGCCATGG + Intergenic
1074168103 10:110904151-110904173 AACCAGGGACAGATGGGCCAAGG + Intronic
1074176543 10:111010611-111010633 ACATATGTATACATGTGCCATGG - Intronic
1075153981 10:119958801-119958823 AACCGTGTGTACCTGGGGCAAGG - Intergenic
1075229718 10:120665121-120665143 TAACAGGTATACATGTGCCACGG - Intergenic
1075276166 10:121094536-121094558 ACACAGGTATACATGTGCCATGG + Intergenic
1076069606 10:127477119-127477141 ACACAGGTATACATGTGCCATGG + Intergenic
1079599327 11:22291636-22291658 ACATATGTATACATGTGCCATGG + Intergenic
1079641655 11:22812903-22812925 ACCCTTGTATACCTGGGACAGGG + Exonic
1080086723 11:28292119-28292141 ACATATGTATACATGTGCCATGG + Intronic
1080155971 11:29111503-29111525 ACCTAGGTATACATGTGCCATGG + Intergenic
1081097706 11:38959530-38959552 ATACATGTATAAATGGGCAAAGG + Intergenic
1081157607 11:39714730-39714752 AAATAGGTATACATGTGCCATGG - Intergenic
1081723658 11:45309587-45309609 AAATATGTATACATGTGCCATGG + Intergenic
1082604678 11:55210463-55210485 ACATATGTATACATGTGCCATGG - Intergenic
1082614836 11:55346990-55347012 AAACATGTATACATTGGGGAAGG + Intergenic
1082636033 11:55595619-55595641 ACATATGTATACATGTGCCATGG + Intergenic
1082875736 11:57986545-57986567 ACACAGGTATACATGTGCCATGG + Intergenic
1082939046 11:58684568-58684590 ACGCAGGTATACATGTGCCACGG - Intronic
1086254807 11:84862904-84862926 ACCTAGGTATACATGTGCCATGG - Intronic
1086276025 11:85130135-85130157 ACACAGGTATACATGTGCCATGG - Intronic
1086806542 11:91250998-91251020 AAGTAGGTATACATGTGCCATGG + Intergenic
1086871685 11:92044983-92045005 ACATATGTATACATGTGCCATGG - Intergenic
1087004469 11:93455440-93455462 ACACAGGTATACATGTGCCATGG - Intergenic
1087269295 11:96095187-96095209 AACCTAGTATAAAGGGGCCAGGG + Intronic
1087528645 11:99351097-99351119 ACCTAGGTATACATGTGCCATGG - Intronic
1087690709 11:101317722-101317744 AAACATGGTTTCATGGGCCAAGG - Intergenic
1088038242 11:105344297-105344319 ACAAATGTATACATGTGCCATGG - Intergenic
1088360925 11:108989386-108989408 ACACAGGTATACATGTGCCATGG + Intergenic
1088665790 11:112092183-112092205 ACACAGGTATACATGTGCCATGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1088856804 11:113762948-113762970 ACACAGGTATACATGTGCCATGG + Intronic
1088884473 11:113996334-113996356 ACCCATGTATACACAGGCTATGG + Intergenic
1089408261 11:118216897-118216919 ATCCATGTATGTATGGGGCAAGG - Intronic
1089575211 11:119437387-119437409 ACACAGGTATACATGTGCCATGG + Intergenic
1089648983 11:119899734-119899756 ACACAGGTATACATGTGCCATGG - Intergenic
1091987498 12:4924103-4924125 ACCCATGTATGCATGAACCAGGG - Intronic
1092739962 12:11618603-11618625 ATCTAGGTATACATGTGCCATGG - Intergenic
1093081541 12:14817413-14817435 ACACAGGTATACATGTGCCATGG + Intronic
1093413094 12:18890319-18890341 ACATAGGTATACATGGGCCATGG + Intergenic
1093486994 12:19663232-19663254 ACACAGGTATACATGTGCCATGG + Intronic
1094427051 12:30326978-30327000 ACCCATGAATACAGTGGCCATGG - Intergenic
1095404717 12:41855338-41855360 AGGTATGTATACATGTGCCATGG - Intergenic
1096424895 12:51492734-51492756 ACCTAGGTATACATGTGCCATGG + Intronic
1097112188 12:56668900-56668922 AATCATTTATTCTTGGGCCATGG + Intronic
1097311536 12:58124378-58124400 ACACAGGTATACATGTGCCATGG + Intergenic
1097324183 12:58257300-58257322 ACACAGGTATACATGTGCCATGG + Intergenic
1097923001 12:65096959-65096981 ACACAGGTATACATGTGCCATGG - Intronic
1099039767 12:77637069-77637091 ACACAGGTATACATGTGCCATGG - Intergenic
1099275724 12:80573548-80573570 ACACAGGTATACATGTGCCATGG + Intronic
1099813545 12:87617438-87617460 ACACAGGTATACATGTGCCAGGG + Intergenic
1099823890 12:87750514-87750536 ACATATGTATACATGTGCCATGG + Intergenic
1100071627 12:90727466-90727488 ACCTAGGTATACATGCGCCATGG + Intergenic
1100264762 12:92965183-92965205 ACACAGGTATACATGTGCCATGG + Intergenic
1100658867 12:96676017-96676039 ACATATGTATACATGTGCCATGG - Intronic
1101070064 12:101064595-101064617 ACACAGGTATACATGTGCCATGG - Intronic
1101972414 12:109324765-109324787 AAATAGGTATACATGTGCCATGG + Intergenic
1102232324 12:111271871-111271893 AAACATGTATACCTGGACAAAGG - Intronic
1102987373 12:117289574-117289596 ACATATGTATACATGTGCCATGG + Intronic
1103047301 12:117747530-117747552 ACACAGGTATACATGTGCCATGG - Intronic
1103155047 12:118677519-118677541 ACATATGTATACATGTGCCATGG + Intergenic
1104287278 12:127435172-127435194 ACACAGGTATACATGTGCCATGG + Intergenic
1104679306 12:130738309-130738331 ACACAGGTATACATGTGCCATGG + Intergenic
1105689383 13:22820790-22820812 ACACAGGTATACATGTGCCATGG - Intergenic
1106628631 13:31446498-31446520 AACTATCTATACATGGGTTAGGG - Intergenic
1106873739 13:34049671-34049693 ACATAGGTATACATGGGCCATGG + Intergenic
1107184543 13:37503152-37503174 ACACAGGTATACATGTGCCATGG - Intergenic
1107472863 13:40706805-40706827 ACACAGGTATACATGTGCCATGG + Intergenic
1107995892 13:45860629-45860651 ACACAGGTATACATGTGCCATGG - Intergenic
1108594418 13:51937536-51937558 ACCCATGTCTGCCTGGGCCAAGG + Exonic
1109346431 13:61119707-61119729 ACACAGGTATACATGTGCCATGG + Intergenic
1109692526 13:65911364-65911386 AAATAGGTATACATGTGCCACGG - Intergenic
1110208769 13:72948154-72948176 ACACAGGTATACATGTGCCATGG - Intronic
1111147629 13:84205342-84205364 ACACAGGTATACATGTGCCATGG + Intergenic
1111284608 13:86072293-86072315 ATACAGGTATACATGTGCCATGG - Intergenic
1111352345 13:87047370-87047392 ACACAGGTATACATGTGCCAGGG - Intergenic
1111814828 13:93139393-93139415 ACACAGGTATACATGTGCCATGG + Intergenic
1112181007 13:97080462-97080484 AAATAGGTATACATGTGCCATGG - Intergenic
1112648161 13:101359124-101359146 ACCTAGGTATACATGTGCCATGG - Intronic
1112785780 13:102950689-102950711 ACCTAGGTATACATGTGCCATGG + Intergenic
1112807292 13:103176871-103176893 ACATATGTATACATGTGCCATGG + Intergenic
1113132674 13:107055848-107055870 ACATATGTATACATGTGCCATGG + Intergenic
1113189597 13:107728629-107728651 ACATATGTATACATGTGCCATGG - Intronic
1113190431 13:107739255-107739277 ACACAGGTATACATGTGCCATGG - Intronic
1113362401 13:109643587-109643609 AGACAGGTATACATGTGCCATGG + Intergenic
1113712066 13:112472424-112472446 AACATTGTGGACATGGGCCACGG + Intergenic
1114148285 14:20004967-20004989 ACACAGGTATACATGTGCCATGG + Intergenic
1114514611 14:23290169-23290191 ACATAGGTATACATGGGCCATGG - Intronic
1114949942 14:27737282-27737304 ACACAGGTATACATGTGCCATGG + Intergenic
1114962379 14:27909453-27909475 ACATAGGTATACATGGGCCATGG - Intergenic
1115357746 14:32466672-32466694 ACATAGGTATACATGGGCCATGG - Intronic
1115480969 14:33860611-33860633 ACACAAGTATACATGTGCCATGG + Intergenic
1115869180 14:37780691-37780713 ACCTAGGTATACATGTGCCATGG + Intronic
1116111645 14:40592458-40592480 ACATATGTATACATGTGCCATGG - Intergenic
1117015654 14:51514443-51514465 ACACAGGTATACATGTGCCATGG - Intronic
1119874895 14:78050546-78050568 ACATATGTATACATGTGCCATGG + Intergenic
1120547370 14:85828540-85828562 ACATATGTATACATGTGCCATGG + Intergenic
1120864330 14:89283135-89283157 AAGCGTGTAGATATGGGCCAGGG - Intronic
1121214948 14:92240505-92240527 AGACATGTATCCATGGGGCAGGG + Intergenic
1122675500 14:103409374-103409396 AAACAGGTATACATGTGCCATGG - Intronic
1123404005 15:20009865-20009887 GACCACTTACACATGGGCCAGGG - Intergenic
1123513344 15:21016511-21016533 GACCACTTACACATGGGCCAGGG - Intergenic
1123971388 15:25511188-25511210 AACCATCTCTAGAGGGGCCAGGG - Intergenic
1124679396 15:31717302-31717324 ACACAGGTATACATGTGCCATGG + Intronic
1125098165 15:35878554-35878576 ACACAGGTATACATGTGCCATGG + Intergenic
1125252198 15:37717853-37717875 ACCTAGGTATACATGTGCCATGG + Intergenic
1125639020 15:41214214-41214236 AAAAATGCATCCATGGGCCAGGG + Intronic
1126236907 15:46396185-46396207 CAACATGTAAACATGTGCCATGG - Intergenic
1126285464 15:47005884-47005906 ACACAGGTATACATGTGCCATGG + Intergenic
1126620016 15:50629237-50629259 AACCATTTCTCCATGTGCCATGG + Intronic
1127168730 15:56276223-56276245 ACATAGGTATACATGGGCCATGG + Intronic
1127182222 15:56433357-56433379 ACACAGGTATACATGTGCCATGG - Intronic
1127338834 15:58019877-58019899 ATGCATGTAAACATGTGCCACGG + Intronic
1127341010 15:58044201-58044223 ACCTAGGTATACATGTGCCATGG + Intronic
1127886939 15:63209812-63209834 ACACAGGTATACATGTGCCATGG + Intronic
1128895290 15:71367354-71367376 ACATATGTATACATGTGCCATGG + Intronic
1130003133 15:80065378-80065400 ACACTTGTATACATGGGGCATGG + Intronic
1130299326 15:82667893-82667915 AAACATGGAGACCTGGGCCAGGG - Intronic
1130750385 15:86705233-86705255 ATACAGGTATACATGTGCCATGG - Intronic
1132171875 15:99666513-99666535 ACACAGGTATACATGTGCCATGG - Intronic
1132216456 15:100065765-100065787 ACATATGTATACATGTGCCATGG + Intronic
1132262301 15:100436568-100436590 ATATATGTATACATGTGCCATGG - Intronic
1133486306 16:6222762-6222784 ACATATGTATACATGTGCCATGG + Intronic
1133486952 16:6228857-6228879 AAACATGTATACATGTGGAATGG - Intronic
1135230434 16:20701586-20701608 ACACAGGTATACATGTGCCATGG + Intronic
1135291635 16:21244360-21244382 ACCTAGGTATACATGTGCCATGG - Intronic
1135386496 16:22045938-22045960 ACATATGTATACATGTGCCATGG + Intronic
1135433430 16:22407001-22407023 ACGCAGGTATACATGTGCCATGG - Intronic
1135625021 16:23987173-23987195 ACACAGGTATACATGTGCCATGG - Intronic
1135824295 16:25713111-25713133 AGGTATGTATACATGTGCCATGG + Intronic
1136514274 16:30758432-30758454 ACGTAGGTATACATGGGCCATGG + Exonic
1136728576 16:32384334-32384356 ACACAGGTATACATGTGCCATGG + Intergenic
1137345706 16:47656893-47656915 AACCAAGTATATTTGGGGCATGG - Intronic
1137457023 16:48625225-48625247 ACACAGGTATACATGTGCCATGG + Intergenic
1138722983 16:59103585-59103607 ACCTAGGTAAACATGGGCCATGG - Intergenic
1138770283 16:59654464-59654486 ATCCATGCTTACATGGGCCTAGG + Intergenic
1138915830 16:61463043-61463065 ACATATGTATACATGTGCCATGG - Intergenic
1138918455 16:61497119-61497141 AAATAGGTATACATGTGCCATGG - Intergenic
1140277833 16:73526677-73526699 AACCATGTTTATCTGAGCCAAGG + Intergenic
1140292017 16:73668367-73668389 ACATAGGTATACATGGGCCATGG + Intergenic
1140602705 16:76497772-76497794 ACTCAGGTATACACGGGCCATGG - Intronic
1140937834 16:79691338-79691360 AGCCATGTGGTCATGGGCCAAGG - Intergenic
1141119930 16:81345674-81345696 ACACAGGTATACATGTGCCATGG - Intronic
1202997862 16_KI270728v1_random:133409-133431 ACACAGGTATACATGTGCCATGG - Intergenic
1203024549 16_KI270728v1_random:445751-445773 ACACAGGTATACATGTGCCATGG - Intergenic
1143722982 17:8826724-8826746 ACACAGGTATACATGTGCCATGG - Intronic
1144035419 17:11360727-11360749 ACACAGGTATACATGTGCCATGG - Intronic
1144052798 17:11511382-11511404 ACACAGGTATACATGTGCCATGG - Intronic
1144195105 17:12886025-12886047 AATTATGTACAAATGGGCCAGGG + Intronic
1145223638 17:21109477-21109499 AACCATTTCTTCTTGGGCCATGG - Intergenic
1146556627 17:33830608-33830630 ACATAGGTATACATGGGCCACGG + Intronic
1146837225 17:36121562-36121584 ACACAAGTATACATGTGCCATGG - Intergenic
1147984289 17:44296007-44296029 CACTATGTATTCAGGGGCCAGGG + Intergenic
1148002156 17:44395745-44395767 AACCATACTTACCTGGGCCAAGG - Intronic
1149392517 17:56206345-56206367 TATCATGTAATCATGGGCCATGG - Intronic
1150103611 17:62445223-62445245 ACATATGTATACATGTGCCATGG - Intronic
1150876322 17:68974915-68974937 ACACAGGTATACATGTGCCATGG + Exonic
1152185032 17:78850557-78850579 AACAGTGTGCACATGGGCCAGGG + Intergenic
1153529199 18:6027080-6027102 ACACAGGTATACATGTGCCATGG + Intronic
1154557894 18:15781766-15781788 ACATATGTATACATGTGCCATGG - Intergenic
1155787909 18:29925325-29925347 ACCTAGGTATACATGTGCCATGG + Intergenic
1156572193 18:38268760-38268782 ACCTAGGTATACATGTGCCATGG - Intergenic
1156700414 18:39818216-39818238 ACATATGTATACATGTGCCATGG - Intergenic
1156937387 18:42726712-42726734 AAACAGGTATACATGTGCCATGG - Intergenic
1157542788 18:48523969-48523991 ACACAGGTATACATGTGCCATGG - Intergenic
1158029982 18:52951327-52951349 ACACAGGTATACATGTGCCACGG + Intronic
1158306083 18:56107137-56107159 CACCAAGTTTTCATGGGCCAGGG + Intergenic
1159075409 18:63675751-63675773 ACACAGGTATACATGTGCCATGG + Intronic
1159089305 18:63829640-63829662 ACCTAGGTATACATGTGCCATGG + Intergenic
1159825788 18:73208803-73208825 ACACAGGTATACATGTGCCATGG + Intronic
1160184322 18:76663145-76663167 ACACAGGTATACATGTGCCATGG + Intergenic
1160330543 18:77987506-77987528 ACACAGGTATACATGTGCCATGG - Intergenic
1164046466 19:21546938-21546960 ACATATGTATACATGTGCCATGG + Intronic
1165121477 19:33561592-33561614 ACACAGGTATACATGTGCCATGG + Intergenic
1165802600 19:38562164-38562186 ACCCATGCACACTTGGGCCACGG + Intronic
1165981200 19:39725768-39725790 ATACAGGTATACATGTGCCATGG - Intergenic
925432702 2:3809676-3809698 ACACAGGTATACATGTGCCATGG + Intronic
926661294 2:15469916-15469938 ACATATGTATACATGTGCCATGG - Intronic
926940170 2:18127246-18127268 AAACAGAAATACATGGGCCAAGG + Intronic
927310510 2:21625822-21625844 ACATATGTATACATGTGCCATGG + Intergenic
927486346 2:23491014-23491036 ACACAGGTATACATGTGCCATGG + Intronic
928328199 2:30336693-30336715 AACCGTGTATCCATGGGGTATGG - Intergenic
928776117 2:34765677-34765699 ACACAAGTATACATGTGCCATGG - Intergenic
929876464 2:45800842-45800864 ATACATGTATGCATGAGCCATGG + Intronic
930433555 2:51312780-51312802 ACATATGTATACATGTGCCATGG + Intergenic
930505301 2:52275610-52275632 ACATATGTATACATGTGCCATGG - Intergenic
930863446 2:56098632-56098654 ACATATGTATACATGTGCCATGG - Intergenic
930915166 2:56677892-56677914 ACACAGGTATACATGTGCCATGG + Intergenic
931532144 2:63228493-63228515 ACATATGTATACATGTGCCATGG + Intronic
932643620 2:73478732-73478754 ACACAGGTATACATGTGCCATGG + Intronic
933609514 2:84419475-84419497 ACCCATATATACATGGTCAATGG + Intergenic
933616858 2:84490853-84490875 AATCATATATTCATGGGCCAGGG - Intergenic
933680268 2:85093773-85093795 ACATATGTATACATGTGCCATGG + Intergenic
934317452 2:91937092-91937114 ACACAGGTATACATGTGCCATGG - Intergenic
934873692 2:97892959-97892981 ACACAGGTATACATGTGCCATGG + Intronic
937315201 2:120927711-120927733 AACCATGTATAGATACACCAAGG - Intronic
937647693 2:124284302-124284324 AACCATTTCTAGATGGGTCAGGG + Intronic
937682721 2:124661913-124661935 ATGCAGGTATACATGTGCCATGG + Intronic
937755748 2:125536003-125536025 ACCCATGCATACATGGCTCATGG + Intergenic
937819541 2:126293902-126293924 ACACAGGTATACATGTGCCATGG + Intergenic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
938549389 2:132366437-132366459 ACCTAAGTATACATGTGCCATGG - Intergenic
938566933 2:132526995-132527017 ACCTAAGTATACATGTGCCATGG + Intronic
939020298 2:136950362-136950384 ACATATGTATACATGTGCCATGG - Intronic
939849213 2:147283792-147283814 ACCTAGGTATACATGTGCCAGGG - Intergenic
940128637 2:150355970-150355992 AACTTTGAATACATGGGCCAAGG + Intergenic
940687611 2:156873215-156873237 ACACAGGTATACATGGGCCATGG - Intergenic
940838045 2:158547340-158547362 AACCATTGATACATGCACCATGG + Intronic
940889152 2:159017804-159017826 ACATAGGTATACATGGGCCATGG - Intronic
941510876 2:166407804-166407826 ACACAGGTATACATGTGCCATGG + Intronic
941686628 2:168455246-168455268 AACCATGTATACATGGGCCATGG + Intergenic
941707653 2:168677081-168677103 ACACAGGTATACATGTGCCATGG + Intronic
941715822 2:168762102-168762124 ACACAGGTATACATGTGCCATGG - Intronic
941826181 2:169899570-169899592 ACCTAGGTATACATGTGCCATGG + Intronic
942854248 2:180526779-180526801 ACATATGTATACATGTGCCATGG + Intergenic
943109033 2:183583057-183583079 ACACAGGTATACATGTGCCATGG + Intergenic
943468722 2:188264746-188264768 ACATATGTATACATGTGCCATGG - Intergenic
943916952 2:193647495-193647517 ACATATGTATACATGTGCCATGG + Intergenic
943919295 2:193681976-193681998 CACCATGAAAAAATGGGCCAAGG - Intergenic
944261442 2:197682192-197682214 ACACAGGTATACATGTGCCATGG + Intergenic
944774378 2:202947574-202947596 ACATATGTATACATGTGCCATGG - Intronic
944856138 2:203769120-203769142 AACCATATATATATCTGCCAAGG + Intergenic
945707827 2:213257588-213257610 ACACAGGTATACATGTGCCATGG - Intergenic
945903791 2:215568129-215568151 ACACAGGTATACATGTGCCATGG - Intergenic
946064699 2:216976478-216976500 ACACAGGTATACATGTGCCATGG + Intergenic
946556585 2:220865253-220865275 AAATAGGTATACATGTGCCATGG - Intergenic
946960142 2:224976331-224976353 ACACAGGTATACATGTGCCATGG - Intronic
947335305 2:229076455-229076477 ACACAGGTATACATGTGCCATGG + Intronic
948250100 2:236520638-236520660 GACAATGTTTACATGGACCATGG + Intergenic
1169933577 20:10859122-10859144 ACACAGGTATACATGTGCCATGG + Intergenic
1170719282 20:18861272-18861294 ACATATGTATACATGTGCCATGG + Intergenic
1170865968 20:20158171-20158193 ACATATGTATACATGTGCCATGG - Intronic
1170866626 20:20163665-20163687 ACCTAGGTATACATGTGCCATGG + Intronic
1171149736 20:22817001-22817023 AAATAGGTATACATGTGCCATGG + Intergenic
1171172850 20:23031354-23031376 AACCATGGCCACATGGGCTATGG - Intergenic
1171178022 20:23069091-23069113 ACCCATATAAAAATGGGCCAAGG + Intergenic
1172642338 20:36448001-36448023 AATAAGGTATACATGCGCCACGG - Intronic
1173110294 20:40181098-40181120 ACATATGTATACATGGGACATGG - Intergenic
1177130225 21:17246555-17246577 ACACAGGTATACATGTGCCATGG - Intergenic
1177528840 21:22334916-22334938 AAAAATGCATATATGGGCCAGGG - Intergenic
1177721154 21:24908520-24908542 ACATATGTATACATGTGCCATGG - Intergenic
1177924767 21:27200126-27200148 ACATAGGTATACATGGGCCATGG - Intergenic
1178286351 21:31328604-31328626 ACACAGGTATACATGTGCCATGG + Intronic
1178331934 21:31704857-31704879 AAGCCAGTATACAAGGGCCATGG + Intronic
1178373552 21:32048006-32048028 ACACAGGTATACATGTGCCATGG - Intergenic
1178813229 21:35903810-35903832 ACATAGGTATACATGGGCCATGG - Intronic
1179102331 21:38365146-38365168 ACCTAGGTATACATGTGCCATGG - Intergenic
1180305630 22:11120882-11120904 ACACAGGTATACATGTGCCATGG - Intergenic
1180544149 22:16483061-16483083 ACACAGGTATACATGTGCCATGG - Intergenic
1180942871 22:19671149-19671171 AACCATGTAACCTTGGGCCTTGG - Intergenic
1181146941 22:20855328-20855350 ACATATGTATACATGTGCCAGGG + Intronic
1181737730 22:24894855-24894877 AAGCATGTATACAGGGATCATGG + Intronic
1181786955 22:25234169-25234191 ACACAGGTATACATGTGCCATGG - Intergenic
1181819009 22:25461114-25461136 ACACAGGTATACATGTGCCATGG - Intergenic
1182949637 22:34361001-34361023 TAGTAGGTATACATGGGCCATGG - Intergenic
1185081411 22:48711334-48711356 CACCTTGTATACATGGGCCGCGG + Intronic
949600035 3:5587729-5587751 ACATATGTATACATGTGCCATGG - Intergenic
949608602 3:5680730-5680752 ACATATGTATACATGCGCCATGG - Intergenic
951135037 3:19095615-19095637 ACACAGGTATACATGTGCCATGG + Intergenic
951459246 3:22931489-22931511 ATACAGGTATACATGTGCCATGG - Intergenic
951939880 3:28065825-28065847 ACACAGGTATACATGTGCCACGG - Intergenic
952001604 3:28791989-28792011 AACCATGGATACAAGAGCTATGG + Intergenic
952717971 3:36500540-36500562 ACACATGTAAACATGTGCCATGG - Intronic
953742830 3:45551955-45551977 CACCCTGTATACAGGGGCCATGG + Intergenic
954949442 3:54457742-54457764 AACCATATATACATGTGCTCTGG + Intronic
955009117 3:54997101-54997123 ACCTAGGTATACATGTGCCATGG - Intronic
956071754 3:65460608-65460630 ACACAGGTATACATGTGCCATGG + Intronic
957174821 3:76793660-76793682 ACATATGTATACATGTGCCATGG + Intronic
957595360 3:82258624-82258646 ACACAGGTATACATGTGCCATGG + Intergenic
957626464 3:82659040-82659062 ACATAGGTATACATGGGCCATGG + Intergenic
957901837 3:86504409-86504431 ACACAGGTATACATGTGCCATGG - Intergenic
958506389 3:94984169-94984191 ACACATGTATACATGTGCCACGG + Intergenic
958545773 3:95548483-95548505 ACATATGTATACATGTGCCATGG - Intergenic
958561624 3:95755822-95755844 ACCCATGTATACATATGCCATGG + Intergenic
958756276 3:98252990-98253012 ACATATGTATACATGTGCCATGG - Intergenic
959119759 3:102219461-102219483 ACATAGGTATACATGGGCCATGG + Intronic
959148214 3:102575189-102575211 ACATATGTATACATGTGCCATGG - Intergenic
959203297 3:103275650-103275672 ACATATGTATACATGTGCCATGG + Intergenic
959233918 3:103693121-103693143 ACCTAGGTATACATGTGCCATGG - Intergenic
959764886 3:110013740-110013762 ACACAGGTATACATGTGCCATGG - Intergenic
959832156 3:110876786-110876808 ACACAGGTATACATGTGCCATGG + Intergenic
959919837 3:111858400-111858422 ACACAGGTATACATGTGCCATGG - Intronic
960777078 3:121268484-121268506 ACCTAGGTATACATGTGCCATGG - Intronic
961096926 3:124165455-124165477 AACCATGCATACATCAGCCTTGG - Intronic
961914105 3:130352236-130352258 ACACAGGTATACATGTGCCATGG - Intronic
962340425 3:134577665-134577687 ACACAGGTATACATGTGCCATGG + Intergenic
962694547 3:137935057-137935079 ACACAGGTATACATGTGCCATGG + Intergenic
962901971 3:139769311-139769333 ACACAGGTATACATGTGCCATGG - Intergenic
962997034 3:140640096-140640118 AACGAGGTATACATGCACCATGG - Intergenic
964029086 3:152115766-152115788 ACCTAGGTATACATGTGCCATGG + Intergenic
964168547 3:153738503-153738525 ACCTATGTATACGTGTGCCATGG - Intergenic
964691205 3:159452193-159452215 AAATAGGTATACATGTGCCATGG + Intronic
964703234 3:159591865-159591887 ACACAGGTATACATGTGCCATGG - Intronic
965002966 3:162981657-162981679 AGGTATGTATACATGTGCCATGG + Intergenic
965234496 3:166098558-166098580 AGCCATGTATACATGGCTCTTGG - Intergenic
966653110 3:182323481-182323503 AACCATGTATAAGGGGGCCAGGG - Intergenic
966804029 3:183792189-183792211 ACCTAAGTATACATGTGCCATGG + Intronic
966961931 3:184948716-184948738 AACCATGTAGACATGGCACCAGG + Intronic
967908990 3:194525627-194525649 AAAAATGCATATATGGGCCAGGG - Intergenic
968020774 3:195386729-195386751 ACACAGGTATACATGTGCCATGG - Intronic
968262045 3:197333387-197333409 ACACAGGTATACATGTGCCATGG + Intergenic
968654335 4:1772119-1772141 ACCCATGAATACATGGCCCCTGG + Intergenic
969915390 4:10485754-10485776 AAAAATGAATAAATGGGCCAGGG - Intergenic
970181815 4:13406063-13406085 ACACAGGTATACATGTGCCATGG + Intronic
970213933 4:13739178-13739200 AGGTATGTATACATGTGCCATGG + Intergenic
971036687 4:22701086-22701108 TGCCAGGTATACATGTGCCATGG + Intergenic
971065659 4:23029541-23029563 ATACATGTTTACATTGGCCAAGG + Intergenic
971181436 4:24331828-24331850 ACATAAGTATACATGGGCCATGG + Intergenic
971521795 4:27561633-27561655 ACACAGGTATACATGTGCCATGG - Intergenic
971840093 4:31840043-31840065 ACACAGGTATACATGTGCCATGG - Intergenic
971948245 4:33309024-33309046 ACACAGGTATACATGTGCCACGG - Intergenic
971989248 4:33869516-33869538 AACCATGAAAACGTGGGCGAAGG + Intergenic
972987678 4:44784547-44784569 AGCAATGTATAGATGGGTCAAGG + Intergenic
973568374 4:52211648-52211670 ACATATGTATACATGTGCCATGG - Intergenic
973896069 4:55414498-55414520 ACACAGGTATACATGTGCCATGG + Intronic
974162309 4:58155649-58155671 ACACAGGTATACATGTGCCATGG - Intergenic
975138710 4:70899286-70899308 ACACAGGTATACATGTGCCATGG + Intergenic
975192271 4:71478681-71478703 ACACAGGTATACATGTGCCATGG - Intronic
975249643 4:72163837-72163859 ACATATGTATACATGTGCCATGG + Intergenic
975424387 4:74209254-74209276 ACATAGGTATACATGGGCCATGG + Intronic
975519257 4:75280935-75280957 ACATATGTATACATGTGCCATGG - Intergenic
975589111 4:75982857-75982879 ACACAGGTATACATGTGCCATGG + Intronic
976030273 4:80743763-80743785 ACACAGGTATACATGTGCCATGG - Intronic
976330485 4:83825729-83825751 ACATAGGTATACATGGGCCATGG + Intergenic
976348300 4:84030545-84030567 ACACAGGTATACATGTGCCATGG - Intergenic
976415095 4:84763477-84763499 ATGTATGTATACATGTGCCATGG - Intronic
976458870 4:85284120-85284142 ACACAGGTATACATGTGCCATGG - Intergenic
976537638 4:86236921-86236943 ACACAGGTATACATGTGCCATGG + Intronic
976769978 4:88640665-88640687 AAATAGGTATACATGTGCCATGG - Intronic
977116874 4:93039397-93039419 AAATAGGTATACATGTGCCATGG - Intronic
977336897 4:95711084-95711106 AAATAGGTATACATGTGCCATGG + Intergenic
977342179 4:95772733-95772755 ACACAGGTATACATGTGCCATGG + Intergenic
977426111 4:96868934-96868956 ACACAGGTATACATGTGCCATGG - Intergenic
977949689 4:102955712-102955734 ACACAGGTATACATGTGCCATGG - Intronic
978041443 4:104068900-104068922 ACACAGGTATACATGTGCCATGG + Intergenic
978122103 4:105092077-105092099 ACATATGTATACATGTGCCATGG - Intergenic
978178977 4:105770434-105770456 AAATAAGTATACATGTGCCATGG + Intronic
978214311 4:106180447-106180469 ACACAGGTATACATGTGCCATGG + Intronic
978660447 4:111119981-111120003 ATGTATGTATACATGTGCCATGG - Intergenic
979458288 4:120951129-120951151 ACACAGGTATACATGTGCCATGG - Intergenic
979717654 4:123860712-123860734 ACACAGGTATACATGTGCCATGG - Intergenic
980170756 4:129287162-129287184 AAGTAGGTATACATGTGCCATGG + Intergenic
980284387 4:130763267-130763289 ACACAGGTATACATGTGCCATGG - Intergenic
980430413 4:132686659-132686681 ACATATGTATACATGTGCCATGG + Intergenic
980670200 4:135994930-135994952 AGCCATGTCTACAAGGGCCAAGG - Intergenic
980824885 4:138061321-138061343 ACACAGGTATACATGTGCCACGG - Intergenic
981133368 4:141183598-141183620 ATATATGTATACATGTGCCATGG + Intronic
981885577 4:149668588-149668610 ATATATGTATACATGTGCCATGG - Intergenic
982394178 4:154898067-154898089 ACATAGGTATACATGGGCCATGG - Intergenic
982525039 4:156467298-156467320 ACATATGTATACATGTGCCATGG + Intergenic
982569612 4:157031837-157031859 ACACAGGTATACATGTGCCATGG - Intergenic
982585130 4:157226836-157226858 AACCATGAACACATGTGCCAGGG + Intronic
982669778 4:158306510-158306532 ACATAGGTATACATGGGCCATGG + Intergenic
982674414 4:158359300-158359322 ACATAGGTATACATGGGCCATGG - Intronic
983331078 4:166330575-166330597 ACACAGGTATACATGTGCCATGG + Intergenic
983743457 4:171164931-171164953 ACATATGTATACATGTGCCATGG - Intergenic
983838298 4:172421094-172421116 ACACAGGTATACATGTGCCATGG - Intronic
983995393 4:174175855-174175877 ACATAGGTATACATGGGCCATGG + Intergenic
984331449 4:178325497-178325519 ACACAGGTATACATGTGCCATGG - Intergenic
984525603 4:180855931-180855953 ACACAGGTATACATGTGCCATGG + Intergenic
985070370 4:186161962-186161984 ACACAGGTATACATGTGCCATGG + Intronic
985299462 4:188472577-188472599 AAATAGGTATACATGTGCCATGG + Intergenic
986183302 5:5414326-5414348 ACACAGGTATACTTGGGCCATGG - Intergenic
986358060 5:6948282-6948304 ACACAGGTATACATGTGCCACGG + Intergenic
986387178 5:7246187-7246209 ACACAGGTATACATGTGCCACGG - Intergenic
986531973 5:8746582-8746604 ACATATGTATACATGTGCCATGG - Intergenic
986838262 5:11666831-11666853 AAATAGGTATACATGTGCCATGG + Intronic
986880147 5:12159573-12159595 ACACAGGTATACATGTGCCATGG - Intergenic
987653452 5:20775110-20775132 ACAGACGTATACATGGGCCATGG + Intergenic
987719663 5:21617394-21617416 ACATAGGTATACATGGGCCATGG - Intergenic
988248313 5:28719143-28719165 ACACATGTAAACATGTGCCATGG - Intergenic
988248335 5:28719704-28719726 ACATATGTATACATGTGCCATGG + Intergenic
988442103 5:31244795-31244817 AACCATCTATGCCTGGGGCAAGG + Intronic
988667156 5:33341748-33341770 ACACAGGTATACATGTGCCATGG + Intergenic
988719748 5:33864918-33864940 ACATAGGTATACATGGGCCATGG - Intronic
988735992 5:34021861-34021883 ACACAGGTATACATGTGCCATGG - Intronic
988742122 5:34086368-34086390 ACAGACGTATACATGGGCCATGG - Intronic
989136281 5:38158482-38158504 ACACAGGTATACATGTGCCATGG + Intergenic
989364482 5:40640342-40640364 AAATAGGTATACATGTGCCATGG - Intergenic
989861186 5:46377320-46377342 ACATATGTATACATGTGCCATGG - Intergenic
990866749 5:60388439-60388461 ACACAGGTATACATGTGCCATGG + Intronic
990888719 5:60624783-60624805 ACACAGGTATACATGTGCCATGG + Intronic
990977719 5:61573896-61573918 AACCATGTGCACATGGGCCTTGG - Intergenic
991163046 5:63527548-63527570 ACACAGGTATACATGTGCCATGG - Intergenic
992897998 5:81263253-81263275 AAATAGGTATACATGTGCCATGG - Intronic
992976318 5:82124361-82124383 AAATAGGTATACATGTGCCATGG + Intronic
992977152 5:82132315-82132337 AGGTATGTATACATGTGCCATGG + Intronic
993117099 5:83732668-83732690 ACACAGGTATACATGTGCCATGG + Intergenic
993401842 5:87463008-87463030 TTCCATGTAAACATGGGCAAAGG - Intergenic
993425683 5:87761673-87761695 ACACAGGTATACATGTGCCATGG + Intergenic
993826406 5:92692406-92692428 ACACAGGTATACATGTGCCATGG - Intergenic
994151482 5:96452571-96452593 ACCTAGGTATACATGTGCCATGG - Intergenic
994155178 5:96495312-96495334 ACACAGGTATACATGCGCCATGG + Intergenic
994339477 5:98609466-98609488 ACCTAGGTATACATGTGCCACGG - Intergenic
994430591 5:99654793-99654815 AAACAGGTATACTGGGGCCATGG - Intergenic
994474343 5:100248526-100248548 ACACAGGTATACATGAGCCATGG - Intergenic
994595699 5:101831753-101831775 ACACAGGTATACATGTGCCATGG + Intergenic
996146637 5:119985217-119985239 ACACAGGTATACATGTGCCATGG + Intergenic
996259621 5:121449816-121449838 ACACAGGTATACATGTGCCATGG - Intergenic
996445084 5:123538660-123538682 ACACAGGTATACATGCGCCATGG - Intronic
996966716 5:129315049-129315071 ACACAGGTATACATGTGCCATGG + Intergenic
997089542 5:130841283-130841305 ACACAGGTATACATGTGCCATGG + Intergenic
997100876 5:130968208-130968230 ACACAGGTATACATGTGCCATGG + Intergenic
997815016 5:137008218-137008240 ACACAGGTATACATGTGCCATGG - Intronic
998294461 5:140953835-140953857 ACCCAGGTAAACATGTGCCATGG + Intronic
998585678 5:143424142-143424164 ACATATGTATACATGTGCCATGG - Intronic
998686780 5:144535905-144535927 ACACAGGTATACATGTGCCATGG - Intergenic
998731135 5:145078523-145078545 AACCATGAAGAGATGGGGCAGGG + Intergenic
998735347 5:145132226-145132248 GAGCATGTATACAAGTGCCATGG + Intergenic
998789431 5:145750023-145750045 ACATATGTATACATGTGCCATGG - Intronic
998875964 5:146599710-146599732 ACATATGTATACATGTGCCATGG + Intronic
998931186 5:147183262-147183284 ACGTATGTATACATGTGCCACGG + Intergenic
998932339 5:147195059-147195081 ACATATGTATACATGAGCCATGG + Intergenic
999409820 5:151341060-151341082 ACCTAGGTATACATGTGCCATGG + Intronic
1000407031 5:160899073-160899095 AAACAGGTATACATGTGCTATGG - Intergenic
1000430184 5:161142399-161142421 ACATATGTATACATGTGCCATGG - Intergenic
1000555782 5:162724331-162724353 ACACAGGTATACATGTGCCATGG + Intergenic
1000595429 5:163210122-163210144 ACACAGGTATACATGTGCCATGG + Intergenic
1000950434 5:167475539-167475561 ACACAGGTATACATGTGCCATGG + Intronic
1001290655 5:170456406-170456428 ACACAGGTATACATGTGCCATGG - Intronic
1001448267 5:171804152-171804174 ACACAGGTATACATGTGCCATGG - Intergenic
1002001468 5:176198752-176198774 TAACAGGTATACATGGGCCATGG - Intergenic
1002252872 5:177940227-177940249 TAACAGGTATACATGGGCCACGG + Intergenic
1002654670 5:180735249-180735271 AACCATTTAAAAATGGGCAAAGG - Intergenic
1002686475 5:181015080-181015102 ACATATGTATACATGTGCCATGG - Intergenic
1002849941 6:985092-985114 ACACAGGTATACATGTGCCATGG + Intergenic
1005261173 6:24062480-24062502 ACACAGGTATACATGTGCCATGG + Intergenic
1010446365 6:75953329-75953351 ACACAGGTATACATGTGCCATGG + Intronic
1011062242 6:83283518-83283540 ACACAGGTATACATGTGCCATGG - Intronic
1011101706 6:83729117-83729139 ACACAGGTATACATGTGCCATGG - Intergenic
1011234371 6:85199943-85199965 AACAATTTTTTCATGGGCCAGGG + Intergenic
1011368848 6:86610463-86610485 ACACAGGTATACATGTGCCATGG - Intergenic
1012096134 6:94964656-94964678 ACACAGGTATACATGTGCCATGG + Intergenic
1012474509 6:99605003-99605025 AGCCATGTATACACAGGCCCTGG + Intergenic
1012667957 6:102001250-102001272 ACACAGGTATACATGTGCCATGG + Intronic
1012674398 6:102097475-102097497 ACACAGGTATACATGTGCCATGG + Intergenic
1013126127 6:107186540-107186562 ACACAGGTATACATGTGCCATGG + Intronic
1013453321 6:110306235-110306257 ACACAGGTATACATGTGCCATGG - Intronic
1013847843 6:114476094-114476116 ACACAGGTATACATGTGCCATGG - Intergenic
1014948968 6:127531668-127531690 ACACAGGTATACATGTGCCATGG - Intronic
1014952380 6:127572086-127572108 ACATAGGTATACATGGGCCATGG + Intronic
1015169299 6:130233313-130233335 AAATAGGTATACATGTGCCACGG + Intronic
1015292450 6:131553139-131553161 ACACAGGTATACATGTGCCATGG + Intergenic
1015846645 6:137526916-137526938 TACATTGTATACATGTGCCATGG - Intergenic
1016242426 6:141946202-141946224 ACACAGGTATACATGTGCCATGG - Intergenic
1016476189 6:144432046-144432068 ACATATGTATACATGTGCCACGG + Intronic
1016560244 6:145388576-145388598 ACACAGGTATACATGTGCCATGG + Intergenic
1017236062 6:152118710-152118732 ACACAGGTATACATGTGCCATGG - Intronic
1018944753 6:168339785-168339807 ATCCATGTAACCATGAGCCAGGG - Intergenic
1019793099 7:3030058-3030080 ACACAGGTATACATGCGCCATGG - Intronic
1019967033 7:4507819-4507841 ACACAGGTATACATGTGCCATGG + Intergenic
1020382530 7:7562734-7562756 AGCCCTGTAAACATGTGCCATGG - Intergenic
1021416245 7:20388698-20388720 ACCTATGTATACACGTGCCATGG + Intronic
1021835959 7:24675452-24675474 ACATATGTATACATGTGCCATGG + Intronic
1022344667 7:29502793-29502815 AAATAGGTATACATGTGCCATGG + Intronic
1022623900 7:32014516-32014538 ACACAGGTATACATGTGCCATGG + Intronic
1023321911 7:39007587-39007609 ACATATGTATACATGTGCCATGG + Intronic
1023455441 7:40333814-40333836 ACATATGTATACATGTGCCATGG + Intronic
1023521714 7:41056232-41056254 AGCCATGTAACCTTGGGCCAAGG + Intergenic
1024602310 7:50994636-50994658 AAATAGGTATACATGTGCCATGG - Intergenic
1026149763 7:67777963-67777985 ACACAGGTATACATGAGCCATGG + Intergenic
1026560089 7:71441530-71441552 ACACAGGTATACATGTGCCATGG + Intronic
1026652817 7:72230204-72230226 ACCTAGGTATACATGTGCCATGG - Intronic
1027537766 7:79427307-79427329 ACATATGTATACATGTGCCATGG - Intronic
1027599312 7:80219772-80219794 ACATATGTATACATGTGCCATGG + Intergenic
1027641115 7:80734992-80735014 AACCATTTAAAAATGGGCAAAGG + Intergenic
1027997278 7:85440082-85440104 ACATAGGTATACATGGGCCATGG - Intergenic
1028346331 7:89788660-89788682 ACACAGGTATACATGTGCCATGG + Intergenic
1028498995 7:91497187-91497209 ACCCAGGTATACATGTGCCATGG + Intergenic
1029241227 7:99164563-99164585 ACATATGTATACATGTGCCATGG - Intergenic
1029373257 7:100162764-100162786 ACACAGGTATACATGTGCCACGG - Intronic
1030226385 7:107156198-107156220 ACACAGGTATACATGTGCCATGG - Intronic
1030584178 7:111396596-111396618 AAATAGGTATACATGTGCCATGG - Intronic
1030612014 7:111700007-111700029 ACACAGGTATACATGTGCCATGG + Intergenic
1030749020 7:113206500-113206522 ACATATGTATACATGCGCCATGG - Intergenic
1030840671 7:114350191-114350213 ACACAGGTATACATGTGCCATGG + Intronic
1031570206 7:123349764-123349786 ACACAGGTATACATGTGCCATGG - Intergenic
1031715000 7:125097919-125097941 ACACAGGTATACATGTGCCATGG - Intergenic
1031725331 7:125230594-125230616 AGCCACGGATACAAGGGCCAAGG - Intergenic
1032295336 7:130632806-130632828 ACACAGGTATACATGTGCCACGG + Intronic
1032659172 7:133964390-133964412 ACCTAGGTATACACGGGCCATGG + Intronic
1033899917 7:146124177-146124199 ACACAGGTATACATGTGCCATGG - Intronic
1033951554 7:146790982-146791004 ACACAGGTATACATGTGCCACGG + Intronic
1034842791 7:154415055-154415077 AAGCATGCAGAGATGGGCCAGGG - Intronic
1035840174 8:2803047-2803069 AACGATGTACAAATGGACCACGG - Intergenic
1035891126 8:3344390-3344412 ACCCAGGTATACATGTGCCATGG - Intronic
1037385149 8:18332108-18332130 ATCCATGAAGAAATGGGCCATGG + Intergenic
1037515110 8:19622992-19623014 ACCTACGTATACATGTGCCAGGG - Intronic
1037984865 8:23283775-23283797 AGCCACGTGAACATGGGCCAAGG - Intronic
1038039977 8:23716350-23716372 ACCTAGGTATACATGTGCCATGG + Intergenic
1039061172 8:33573376-33573398 ACACAGGTATACATGTGCCATGG - Intergenic
1039701720 8:39968807-39968829 ACATATGTATACATGTGCCATGG - Intronic
1041142469 8:54837262-54837284 AAGCATGTATCCATTGACCATGG - Intergenic
1042140455 8:65673534-65673556 AAATAGGTATACATGTGCCATGG - Intronic
1042763982 8:72300815-72300837 ACCTAGGTATACATGTGCCATGG + Intergenic
1042783175 8:72514904-72514926 ATACAGGTATACATGTGCCATGG - Intergenic
1043048263 8:75354373-75354395 ATATATGTATACATGTGCCATGG + Intergenic
1043225370 8:77721360-77721382 ACACAGGTATACATGTGCCACGG + Intergenic
1043296708 8:78672959-78672981 ATACAGGTATACATGTGCCATGG + Intronic
1043641568 8:82458042-82458064 ACACAGGTATACATGTGCCATGG + Intergenic
1043962014 8:86427327-86427349 ACACAGGTATACATGTGCCATGG - Intronic
1045103682 8:98869906-98869928 ACATATGTATACATGTGCCATGG + Intronic
1045684110 8:104693338-104693360 ACACAGGTATACATGTGCCATGG - Intronic
1045794746 8:106029356-106029378 ATATATGTATACATGTGCCATGG - Intergenic
1046285495 8:112087880-112087902 ACCTAGGTATACATGTGCCATGG - Intergenic
1046455951 8:114461539-114461561 ACATAGGTATACATGGGCCATGG + Intergenic
1046464113 8:114580440-114580462 ACATATGTATACATGTGCCATGG + Intergenic
1046466063 8:114604781-114604803 ACATAGGTATACATGGGCCATGG - Intergenic
1046542128 8:115599384-115599406 ACACAGGTATACATGTGCCATGG + Intronic
1046616484 8:116483400-116483422 AAATACGTATACATGTGCCATGG + Intergenic
1046781042 8:118215525-118215547 ACATATGTATACATGTGCCATGG + Intronic
1046887439 8:119382875-119382897 ACATAGGTATACATGGGCCATGG - Intergenic
1046983144 8:120359120-120359142 ACACAGGTATACATGTGCCATGG + Intronic
1047002040 8:120582856-120582878 ACACAGGTATACATGTGCCATGG - Intronic
1047226045 8:122956175-122956197 AACCATGTAGACACGTGTCATGG - Intronic
1047374681 8:124284776-124284798 ACACAGGTATACATGTGCCATGG + Intergenic
1047484101 8:125313035-125313057 ACACAGGTATACATGTGCCATGG - Intronic
1047550147 8:125862403-125862425 AACCATGTAACCATATGCCAAGG + Intergenic
1049716081 8:144093271-144093293 ACAGATGTATACATGTGCCATGG + Intergenic
1049951357 9:647144-647166 AACCAAGTATAAATTTGCCATGG + Intronic
1050065816 9:1758411-1758433 ACACAGGTATACATGTGCCACGG - Intergenic
1050451277 9:5783880-5783902 ACATATGTATACATGTGCCATGG - Intronic
1050632425 9:7574451-7574473 ACATATGTATACATGTGCCATGG + Intergenic
1050788256 9:9431982-9432004 ACGTATGTATACATGTGCCATGG - Intronic
1050868114 9:10530001-10530023 ACATAGGTATACATGGGCCATGG - Intronic
1051830399 9:21269626-21269648 ACATAGGTATACATGGGCCATGG + Intergenic
1052503941 9:29328645-29328667 AGGTATGTATACATGTGCCATGG + Intergenic
1052505931 9:29354815-29354837 ATACAGGTATACATGTGCCATGG + Intergenic
1052668070 9:31519544-31519566 AAACGTGTATATCTGGGCCAGGG + Intergenic
1054793476 9:69277254-69277276 ACACAGGTATACATGTGCCATGG + Intergenic
1055074162 9:72196636-72196658 ACACAGGTATACATGTGCCATGG + Intronic
1055398855 9:75901567-75901589 ACACAGGTATACATGTGCCATGG - Intronic
1057290873 9:93806698-93806720 ACCCAGGTATACATGTGCCATGG - Intergenic
1057460888 9:95260619-95260641 AGCCAGGTATACACGTGCCATGG - Intronic
1059028576 9:110664941-110664963 ACACAGGTATACATGTGCCATGG + Intergenic
1059806419 9:117805923-117805945 ACCTAGGTATACATGTGCCATGG + Intergenic
1059947715 9:119428906-119428928 ACCTAGGTATACATGGGTCATGG - Intergenic
1060769671 9:126323063-126323085 ACACAGGTATACATGTGCCATGG - Intergenic
1061952245 9:133943092-133943114 AGCCATGTCGACATCGGCCAGGG + Intronic
1062000278 9:134212413-134212435 AACCATGAATACATAGGGCAAGG + Intergenic
1203378372 Un_KI270435v1:3249-3271 ACATATGTATACATGTGCCACGG + Intergenic
1185511760 X:669026-669048 ACATATGTATACATGTGCCATGG + Intergenic
1185677938 X:1863910-1863932 ACACAGGTATACATGTGCCATGG + Intergenic
1185679927 X:1880108-1880130 ACACAGGTATACATGTGCCATGG - Intergenic
1185842438 X:3404641-3404663 ATGTATGCATACATGGGCCAAGG + Intergenic
1186701688 X:12096922-12096944 ATACATGTATACATTAGCCAGGG + Intergenic
1187578189 X:20580084-20580106 CACCATGTACAGATTGGCCAAGG - Intergenic
1187790886 X:22948939-22948961 ACACAGGTATACATGTGCCATGG + Intergenic
1187845458 X:23531927-23531949 TACTATGTATACATTGGCCTAGG + Intergenic
1188548053 X:31332027-31332049 AAACATGTATACCTTAGCCATGG + Intronic
1188722452 X:33539881-33539903 TACCATCTAAACATGTGCCAGGG - Intergenic
1188821075 X:34775884-34775906 ACACAGGTATACATGTGCCATGG + Intergenic
1189125331 X:38439445-38439467 ACCCATGAATAAATGGGTCAAGG - Intronic
1189843587 X:45109049-45109071 ACATATGTATACATGTGCCATGG - Intronic
1190122450 X:47673140-47673162 ACACAGGTATACATGTGCCATGG + Intergenic
1191081403 X:56514036-56514058 AAATAGGTATACATGTGCCATGG - Intergenic
1191188397 X:57638295-57638317 ACACAGGTATACATGTGCCATGG - Intergenic
1191591839 X:62894175-62894197 ACACAGGTATACATGTGCCATGG - Intergenic
1191878437 X:65820438-65820460 ACACAGGTATACATGTGCCATGG - Intergenic
1191908460 X:66121757-66121779 ACATATGTATACATGTGCCATGG + Intergenic
1191963043 X:66724676-66724698 ACACAGGTATACATGTGCCATGG - Intergenic
1191963535 X:66729826-66729848 ACACAGGTATACATGTGCCATGG + Intergenic
1192019069 X:67364911-67364933 ACACAGGTATACATGTGCCATGG - Intergenic
1192097039 X:68222857-68222879 ACATATGTATACATGTGCCATGG - Intronic
1192556619 X:72095091-72095113 AACCATGGCAACAGGGGCCATGG - Intergenic
1192702641 X:73492098-73492120 AAATAGGTATACATGTGCCACGG + Intergenic
1192821447 X:74649872-74649894 ACACAGGTATACATGTGCCATGG + Intergenic
1192857684 X:75031302-75031324 ACTCAGGTATACATGTGCCATGG + Intergenic
1192914879 X:75641378-75641400 ACACAGGTATACATGTGCCATGG + Intergenic
1193011459 X:76679438-76679460 ACATATGTATACATGTGCCATGG - Intergenic
1193235857 X:79106403-79106425 ACATATGTATACATGTGCCATGG - Intergenic
1193259261 X:79386163-79386185 ACCTATGTAAACATGTGCCATGG - Intergenic
1193335202 X:80279802-80279824 ACACAGGTATACATGTGCCATGG - Intergenic
1193393120 X:80952693-80952715 AAATAGGTATACACGGGCCATGG - Intergenic
1193653725 X:84171725-84171747 ACACAGGTATACATGTGCCATGG + Intronic
1193800840 X:85934337-85934359 ACATATGTATACATGTGCCATGG + Intronic
1193955343 X:87853291-87853313 ACCTAGGTATACATGTGCCATGG + Intergenic
1193963608 X:87955279-87955301 ACACATGTATACACGTGCCACGG - Intergenic
1194022186 X:88704391-88704413 ACATATGTATACATGTGCCATGG - Intergenic
1194117920 X:89925933-89925955 ACACAGGTATACATGTGCCATGG + Intergenic
1194532739 X:95071081-95071103 ACACAGGTATACATGTGCCATGG - Intergenic
1194913961 X:99682107-99682129 ACATATGTATACATGTGCCATGG - Intergenic
1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG + Intergenic
1195549759 X:106154113-106154135 ACACAGGTATACATGTGCCATGG - Intergenic
1195771516 X:108356260-108356282 ACATATGTATACATGTGCCATGG - Intronic
1195902399 X:109812706-109812728 ACACACGTATACATGTGCCATGG - Intergenic
1196115857 X:111998987-111999009 ACCTAGGTATACATGTGCCATGG + Intronic
1196232200 X:113237389-113237411 ACATATGTATACATGTGCCATGG + Intergenic
1196387845 X:115177687-115177709 ACACAGGTATACATGTGCCATGG + Intronic
1196693288 X:118583358-118583380 ACACAGGTATACATGTGCCATGG - Intronic
1197636960 X:128926125-128926147 AGGTATGTATACATGTGCCATGG + Intergenic
1198382286 X:136095227-136095249 AACACTGTATACTTGGGCTATGG + Intergenic
1198794548 X:140381521-140381543 ACACAGGTATACATGTGCCATGG - Intergenic
1199377127 X:147126569-147126591 ACGTATGTATACATGTGCCATGG + Intergenic
1199451739 X:147985375-147985397 ACACAGGTATACATGTGCCATGG + Intronic
1199453388 X:147998533-147998555 ACATAGGTATACATGGGCCATGG - Intronic
1201184756 Y:11389475-11389497 ACACAGGTATACATGTGCCATGG - Intergenic
1201234865 Y:11899556-11899578 ACGTATGTATACATGTGCCATGG - Intergenic
1201249811 Y:12045441-12045463 ACATATGTATACATGTGCCATGG - Intergenic
1201386616 Y:13447028-13447050 ACACAGGTATACATGTGCCATGG + Intronic
1201514175 Y:14799326-14799348 AACCATGTATATATGGCGGATGG - Intronic
1201949275 Y:19546310-19546332 ACACAGGTATACATGTGCCATGG + Intergenic
1202061760 Y:20896466-20896488 TAACAGGTATACATGTGCCATGG - Intergenic