ID: 941686901

View in Genome Browser
Species Human (GRCh38)
Location 2:168456575-168456597
Sequence ATGAAGATACAGAAGGCCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 425}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941686901_941686908 7 Left 941686901 2:168456575-168456597 CCCCTGGCCTTCTGTATCTTCAT 0: 1
1: 0
2: 1
3: 35
4: 425
Right 941686908 2:168456605-168456627 CTCATCTTCGAGAGGTAAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 78
941686901_941686907 -1 Left 941686901 2:168456575-168456597 CCCCTGGCCTTCTGTATCTTCAT 0: 1
1: 0
2: 1
3: 35
4: 425
Right 941686907 2:168456597-168456619 TGGTGCGGCTCATCTTCGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 30
941686901_941686909 8 Left 941686901 2:168456575-168456597 CCCCTGGCCTTCTGTATCTTCAT 0: 1
1: 0
2: 1
3: 35
4: 425
Right 941686909 2:168456606-168456628 TCATCTTCGAGAGGTAAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941686901 Original CRISPR ATGAAGATACAGAAGGCCAG GGG (reversed) Exonic
901144308 1:7054737-7054759 ATGAGAACACTGAAGGCCAGAGG - Intronic
901830384 1:11888587-11888609 ATGAAGACACACAACTCCAGAGG + Intergenic
903035134 1:20487868-20487890 ATGGGGAAACAGAAGTCCAGAGG + Intergenic
903143515 1:21354993-21355015 ATGAAGATCCTGAGGGTCAGAGG + Intergenic
903594814 1:24485900-24485922 ATGAGGAAACAGAGGCCCAGAGG - Intergenic
903783097 1:25835179-25835201 CTGAAGATTCTCAAGGCCAGCGG - Exonic
904137087 1:28321528-28321550 ATGGAGAAGCAGAAGGGCAGAGG - Intergenic
904322760 1:29707681-29707703 AGAGAGACACAGAAGGCCAGAGG + Intergenic
905823934 1:41015389-41015411 ATGAAGAAACTGAAGCACAGAGG + Intergenic
906103134 1:43275873-43275895 AAGAAAAAACAGAAGCCCAGAGG + Intergenic
906701944 1:47865940-47865962 ATGAAGAGACTGAAGCACAGAGG - Intronic
906785369 1:48610940-48610962 ATCAAAATACAGAAGGGCAGGGG + Intronic
907662803 1:56408862-56408884 ATGAAGAAACTGAAGCTCAGGGG - Intergenic
907738561 1:57140344-57140366 ATGAGGAAACATAAGGCCAGGGG + Intronic
908523950 1:64969637-64969659 AGGAAGATGCAAAAGGCCTGAGG + Intergenic
908638273 1:66192414-66192436 AGGAGGATGCAGAAGGGCAGTGG - Intronic
909823187 1:80092371-80092393 ATGAAGCTGCTGAAGGGCAGTGG - Intergenic
910428156 1:87135962-87135984 AGGAATATAAAGAAAGCCAGAGG + Intronic
911237102 1:95423240-95423262 AGAGAGAAACAGAAGGCCAGGGG + Intergenic
912670086 1:111617418-111617440 TTGATGACACAGAAGGCAAGAGG - Intronic
912727163 1:112068535-112068557 AGGAAGAAAGAGAGGGCCAGAGG + Intergenic
913408684 1:118526127-118526149 TTGTAGAAACAGAAGTCCAGGGG + Intergenic
914216072 1:145629753-145629775 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914468641 1:147952406-147952428 ATGGAGAAGCAGAAGACCAGAGG + Intronic
915248059 1:154569866-154569888 AGGAGGAGAGAGAAGGCCAGGGG - Intronic
915984890 1:160454741-160454763 ATGAAGAAACTGAGGTCCAGAGG + Intergenic
916811665 1:168311300-168311322 ATGAAGAAACTGAAGCTCAGAGG + Intronic
917936821 1:179876611-179876633 ATGAGGATATAAAAGGCCAGTGG - Intronic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
920040133 1:203090162-203090184 TAGAAGATGCTGAAGGCCAGAGG - Intergenic
920223502 1:204421664-204421686 ATGAAGAAACTGAAGCTCAGAGG - Intergenic
920848332 1:209611749-209611771 CTGAGGTTGCAGAAGGCCAGAGG + Intronic
922178187 1:223213431-223213453 AAGAAGAGACAGAAGGCCCTGGG + Intergenic
923540945 1:234887794-234887816 ATGAACAAACTGAAGGCAAGAGG - Intergenic
924067967 1:240245790-240245812 GTGAAGCAACAGAAGGCCTGGGG - Intronic
924124601 1:240837215-240837237 AGGAAGAAACAAAAGGCCTGAGG + Intronic
1062922966 10:1293660-1293682 ATGAAGATACACATCTCCAGAGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063774778 10:9250366-9250388 ATGAAGAAACAGAAAACCACAGG + Intergenic
1064874793 10:19981350-19981372 ATGAAGAAACTGAGGCCCAGAGG + Intronic
1066497373 10:35955294-35955316 ATGAGGCTACAGAAAACCAGTGG + Intergenic
1068840315 10:61606054-61606076 ATGAATATACGGAAAGCCATTGG + Intergenic
1069075560 10:64035153-64035175 ATGGAGACAGAGAAGCCCAGAGG - Intergenic
1070333795 10:75437062-75437084 ATGAAGTTACTGAAGGAGAGTGG + Intronic
1070437076 10:76403874-76403896 AGGAAGAGATGGAAGGCCAGGGG - Intronic
1070554098 10:77514826-77514848 GTGAAGAGGCAGAAGGTCAGAGG - Intronic
1070751489 10:78966584-78966606 ATGAAGAAACGGAGGCCCAGGGG + Intergenic
1070751837 10:78968478-78968500 ATGAAGAAACTGAGGCCCAGGGG + Intergenic
1071303158 10:84273025-84273047 ATGAAGGTCCAGAAATCCAGAGG - Intergenic
1071784751 10:88886673-88886695 ATTTAGAAACAGGAGGCCAGTGG + Intronic
1072501298 10:96020585-96020607 ATGAGGAGACAGGAGCCCAGAGG + Intronic
1072831459 10:98663063-98663085 ATGAACACACATAAGGGCAGGGG + Intronic
1073038420 10:100580631-100580653 ATAAAGAAACAGAGGCCCAGTGG - Intergenic
1073742458 10:106423759-106423781 ATGAAGAAACTGAAGCCCACAGG + Intergenic
1074563475 10:114554924-114554946 ATGAAAAAACTGAAGCCCAGTGG - Intronic
1075062121 10:119264487-119264509 ATGACGATAAAGATGGCCAGTGG + Intronic
1075145135 10:119876294-119876316 ATGAAAATGTAAAAGGCCAGGGG + Intronic
1076493358 10:130879238-130879260 TAGAAGAAACAGAAGGCCATGGG - Intergenic
1076554693 10:131313509-131313531 AGGCAGAGACAGAAGGCCAGGGG + Intergenic
1076708252 10:132314134-132314156 ATATAGATGCAGAAGGGCAGAGG - Intronic
1077419368 11:2443421-2443443 GTGAAGGTGCAGAAGGGCAGCGG - Intergenic
1077715960 11:4580890-4580912 ATGAAAATACAAGAGGCTAGAGG - Intergenic
1077859965 11:6169347-6169369 ATGAAGATTCATGAGCCCAGAGG + Exonic
1077899195 11:6476068-6476090 ATTAGGATACAGAAGTACAGAGG - Exonic
1078845525 11:15115644-15115666 GAGAAGAGACAGGAGGCCAGGGG + Intronic
1079495465 11:21038445-21038467 ATACAGAAACAGAAGGCCAAGGG + Intronic
1080195342 11:29601824-29601846 ACGTAGATACAGAAAGGCAGAGG + Intergenic
1080766953 11:35305888-35305910 AGGAAGAGAGAGAAGGGCAGAGG - Intronic
1080885565 11:36364461-36364483 ATGAAGACACCGAAGAGCAGAGG - Intronic
1081711813 11:45221697-45221719 ATGAAGATACAGGAGGGAAGAGG + Intronic
1081766602 11:45615657-45615679 ATGAAGACACACAGGGGCAGAGG - Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083164336 11:60874409-60874431 TTCCAGATACAGAAGGGCAGGGG - Intronic
1084023788 11:66435235-66435257 ATGAGGAAATAGAAGGCCAAGGG + Exonic
1084637576 11:70402371-70402393 ATGAAGATACTAAAAACCAGTGG - Intronic
1084704720 11:70809517-70809539 ATAAAGTTACAGAAGGGCAATGG + Intronic
1085107560 11:73858830-73858852 ATGAAGAAACTGAGGCCCAGAGG + Intronic
1085113874 11:73912820-73912842 AAGAAGAAACTGAAGGCCTGTGG - Intronic
1085218545 11:74852910-74852932 ATGAAGGTACTGAAGTCCAAGGG + Intronic
1085382494 11:76133003-76133025 ATGAAGAAACTGAAGCACAGAGG - Intronic
1085389659 11:76175931-76175953 ATGGAGAAACAGAAGCCCACGGG + Intergenic
1086095494 11:83046374-83046396 ATGAGGAAACTGAAGGCCAAAGG - Intronic
1086401062 11:86461259-86461281 ATGAGGAAACTGAAGCCCAGGGG - Intronic
1087812178 11:102620575-102620597 ATAAAAGTACAGGAGGCCAGGGG + Intronic
1087849937 11:103016521-103016543 TTGAAGAAACAGAAGCCCATAGG - Intergenic
1088679560 11:112227198-112227220 ACGACGATACGGAGGGCCAGAGG - Intronic
1090269352 11:125374981-125375003 ATGAAGGTTCATATGGCCAGTGG + Intronic
1090616032 11:128516071-128516093 ATGCAGATACAGAAAGACATAGG - Intronic
1090792503 11:130103854-130103876 GTAAAAATATAGAAGGCCAGAGG + Intronic
1091171811 11:133526319-133526341 AGGCAGATATAGAAGGCAAGAGG + Intronic
1091192798 11:133708355-133708377 ATGCAGAAACAGAAGCACAGAGG - Intergenic
1091625120 12:2115658-2115680 ATGCAGATGCAGTAGGCCCGAGG - Intronic
1091698056 12:2641271-2641293 ATGAGGACACAAAAGGCCAGAGG + Intronic
1091988814 12:4937771-4937793 ATGGAAATACAGCAGGCAAGGGG + Intergenic
1092602101 12:10078543-10078565 ATGAAGGTAAACAAGGCAAGAGG - Intronic
1092625835 12:10327331-10327353 AGCAAGAAACAGAAGGCCAGAGG - Intergenic
1093331478 12:17848340-17848362 ATGAGAAAACAGAAGGCTAGAGG + Intergenic
1094049839 12:26206907-26206929 ATGAAAATACAGAGGGAGAGTGG - Intronic
1094166696 12:27450381-27450403 ATGAGGACACAGAGGTCCAGTGG - Intergenic
1094479023 12:30865680-30865702 ATGAAGAAAAAGAGGGTCAGTGG + Intergenic
1095478746 12:42611806-42611828 ATGAAGATACAGAGGGGAAGAGG + Intergenic
1096417734 12:51428046-51428068 TTGAAGAAACAGAAAGCCAGAGG - Intronic
1096658550 12:53106532-53106554 ATGAAAATACAGACCCCCAGGGG - Intronic
1097075042 12:56386681-56386703 CTGAAGAACCAGAAGGCTAGAGG - Intergenic
1097755837 12:63406017-63406039 ATGAAGAGAGAGAAGTGCAGGGG - Intergenic
1098919223 12:76287836-76287858 ATGAAGAGACAGAAGTCAAAGGG - Intergenic
1099774809 12:87111711-87111733 ATAAAGAAACGGAGGGCCAGAGG - Intergenic
1100372040 12:93977224-93977246 ATGAAGAAACAAAAGTTCAGAGG - Intergenic
1100543696 12:95581374-95581396 ATCAGGATACAGGGGGCCAGGGG - Intergenic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1101503328 12:105324786-105324808 ATAAAGATTCTGCAGGCCAGAGG - Intronic
1101749143 12:107568813-107568835 GTGAAGACACCGAAGCCCAGGGG + Intronic
1102684239 12:114711987-114712009 ACAAAGACACAGAAGGACAGAGG - Intergenic
1103158369 12:118707217-118707239 AGGCAGTGACAGAAGGCCAGAGG - Intergenic
1103367828 12:120395855-120395877 ATGAAGAAACCGAGGCCCAGAGG + Intergenic
1103801431 12:123540373-123540395 ATAAAGATTAAGAAGGACAGTGG + Intergenic
1104038673 12:125115551-125115573 ATAAAGACTCAGCAGGCCAGGGG - Intronic
1104797794 12:131531712-131531734 ATGAGGATGCAGAACTCCAGGGG - Intergenic
1105986445 13:25572077-25572099 CTGAAGAGACTGAAGCCCAGTGG - Intronic
1106929649 13:34650538-34650560 AATAACATACAGTAGGCCAGGGG - Intergenic
1107403819 13:40094789-40094811 ATGAAGAAACTGAAGCCAAGAGG + Intergenic
1107502857 13:40998188-40998210 ATGAAAATATGGAAGGCCATGGG + Intronic
1108144781 13:47464652-47464674 CTGAAAATTCAAAAGGCCAGAGG + Intergenic
1108932062 13:55837491-55837513 ATGAGGAAACAGAAGCCCATAGG - Intergenic
1109272854 13:60273544-60273566 ATGAAGAAACTGAGGCCCAGAGG + Intergenic
1109338656 13:61026089-61026111 AAAAAGATACAGAAGAACAGAGG + Intergenic
1109678240 13:65709596-65709618 ATGAGGAAACAGAAGCACAGAGG - Intergenic
1110291418 13:73811406-73811428 ATGAAGATACTGAGGATCAGAGG - Intronic
1110469446 13:75842287-75842309 AGGAAGAAACAGGAGGCCAATGG - Intronic
1110908790 13:80928597-80928619 ATGAAGAGAGAGAGGGACAGAGG - Intergenic
1112192097 13:97188119-97188141 ATGAAGTTACAAAAGGTGAGAGG + Intergenic
1112362989 13:98733773-98733795 ATGAAGAAATGGAAGCCCAGAGG - Intronic
1112495702 13:99902503-99902525 AGGAAGAGAAAAAAGGCCAGTGG - Intergenic
1112615924 13:101005390-101005412 ATTAAGCAACAGAAGGCCATGGG - Intergenic
1113153963 13:107296313-107296335 AAGAAGATACAGTAGCCTAGTGG + Intronic
1115123636 14:29967557-29967579 ATGAAGAGAAAGAAGGGTAGAGG + Intronic
1116345875 14:43792949-43792971 ATGAAGATAATAAAGGCTAGAGG - Intergenic
1116447914 14:45033293-45033315 ATGTAGAAAGAGAATGCCAGTGG - Intronic
1116466903 14:45244503-45244525 ATGAAGTGACAGAAGGACAAAGG - Intronic
1118824564 14:69368543-69368565 ATGAAGTTACAGAAGGACTGTGG - Intergenic
1119444095 14:74649137-74649159 GTGAAGAAACTGAAGCCCAGAGG - Intergenic
1119476909 14:74935557-74935579 ATGGAGAGAGAGAAGGGCAGTGG - Intergenic
1119541017 14:75438269-75438291 ATTCTGATACAGAAGGCCTGGGG - Intronic
1120962266 14:90136210-90136232 ATGCAGAAACAGCAGGCCAGAGG - Intronic
1121228947 14:92342280-92342302 ATGCAGATACAGGAGGTCTGGGG + Intronic
1121520730 14:94584599-94584621 ATGAAGAAACTGAGGCCCAGAGG + Intronic
1121661189 14:95636350-95636372 ATGAAGAAACTGAGGGTCAGAGG - Intergenic
1121780575 14:96619361-96619383 ATGGAGATGCAGAAAGACAGTGG + Intergenic
1122005308 14:98698592-98698614 ATGGAGATACAGAAGTCCCTGGG - Intergenic
1122348723 14:101075903-101075925 ATGAGGACACGGAAGCCCAGAGG - Intergenic
1122575451 14:102738967-102738989 ATGGAGAAACAGAACACCAGGGG - Intergenic
1124387587 15:29223355-29223377 AGGAAGAAACAGAATCCCAGAGG - Intronic
1124805365 15:32876331-32876353 ATGTAGGTATAGAAGGCCAGGGG + Intronic
1126013386 15:44325815-44325837 CCTAAGATACAGCAGGCCAGAGG - Intronic
1126376634 15:48003200-48003222 ATGAGGAAACTGAAGCCCAGAGG - Intergenic
1127686817 15:61354009-61354031 ATGAAGTTACAGATGGGAAGAGG + Intergenic
1128120912 15:65145403-65145425 ATAAAGAAACTGAAGCCCAGAGG - Intergenic
1130862164 15:87900814-87900836 ATGAGAACACAGAAGGCCAGGGG - Intronic
1130869348 15:87958191-87958213 ATGAAGATTCAGAAGGGCAGTGG + Intronic
1131899829 15:97075398-97075420 ATGAAGATACAGAAAGGCAATGG - Intergenic
1131938495 15:97534399-97534421 GTGAAGATAATGAAGGGCAGAGG + Intergenic
1133090437 16:3400352-3400374 ATGAACATAATGAAGGCAAGGGG - Intronic
1133482591 16:6185426-6185448 ATGAAGAAACCGAAGTTCAGAGG + Intronic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1134175199 16:12000340-12000362 ATGAAGAGACTGAAGCTCAGAGG + Intronic
1134201131 16:12199989-12200011 ATGAAGTCACAGCAGGCCACGGG + Intronic
1134538836 16:15048031-15048053 CTGAACATACAGAAGGCCCTGGG + Exonic
1134815519 16:17202484-17202506 AGGAAGAGAAAGAAGGCCAGAGG - Intronic
1136238919 16:28932486-28932508 ATGAAAAGCCAGATGGCCAGGGG - Exonic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1137983011 16:53085573-53085595 ATAAAGACACACAAGGCCACAGG + Intronic
1138330014 16:56205959-56205981 ATGAGCAGAAAGAAGGCCAGTGG + Intronic
1139815960 16:69672183-69672205 ATGTAGTTGCATAAGGCCAGAGG - Intronic
1140574677 16:76152737-76152759 ATGGAGGAACAGAAGGTCAGTGG + Intergenic
1141546994 16:84776787-84776809 ATGAGGATTCAGGAGGGCAGGGG - Intronic
1142591402 17:1007701-1007723 ATGAAGAAACCGAAGTACAGAGG + Intronic
1143584452 17:7844307-7844329 TTGAAGACCCAGAAAGCCAGGGG + Intronic
1144094924 17:11891771-11891793 AAGACGATACTGAAGGCCTGGGG - Exonic
1146506898 17:33413622-33413644 ATGAAGATGCAAAAGGCTACTGG - Intronic
1147500171 17:40955581-40955603 ATGCAGATACAGGAGGTCTGGGG + Intergenic
1149440472 17:56669590-56669612 ATGAAAATCCAGGAGGACAGGGG + Intergenic
1150652626 17:67019852-67019874 TTCAAGATGCAGAAGCCCAGAGG + Intronic
1151867901 17:76816562-76816584 ATGAAGGATTAGAAGGCCAGAGG - Intergenic
1154016263 18:10620586-10620608 AGGTAAAAACAGAAGGCCAGAGG - Intergenic
1154985802 18:21549664-21549686 ATTAGGATACAGAAGGTCAAAGG + Intronic
1156231955 18:35162257-35162279 ATCAAGATACAGAACTGCAGTGG + Intergenic
1157248395 18:46072639-46072661 TTTAAGCTACAGAAGGCCTGGGG + Intergenic
1157937550 18:51890018-51890040 ATGAAGACTCTGAAGCCCAGAGG + Intergenic
1159936416 18:74371657-74371679 CTGGAGATGCAGAAGGCTAGGGG + Intergenic
1161872670 19:6882395-6882417 TGTAAGATACAGAAAGCCAGAGG - Intergenic
1162341089 19:10091905-10091927 TTGAAGATACAGGAGACCTGGGG - Intronic
1164891327 19:31826086-31826108 AGGAGGACACAGAGGGCCAGAGG - Intergenic
1164903151 19:31945495-31945517 ATGATGGAACAGAAGGCAAGAGG - Intergenic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1165708529 19:37993178-37993200 ATGAAGAAACTGAGGGGCAGGGG - Intronic
1165734161 19:38165118-38165140 AAACAGAGACAGAAGGCCAGGGG - Intronic
1167298826 19:48667554-48667576 ATGAAGAAATAGAGGGGCAGAGG + Intronic
1167398862 19:49251470-49251492 ATAAAGTTACTGAAGACCAGTGG - Intergenic
1167493873 19:49806888-49806910 ATAAAAATACAAAAGGCCGGAGG - Exonic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1168165102 19:54541814-54541836 ATGGAGATAGAGGTGGCCAGAGG - Intronic
925497833 2:4472026-4472048 AAGAAGATACAGAAACCCACAGG - Intergenic
926295837 2:11567880-11567902 ATGAGGACGCAGAAGCCCAGGGG - Intronic
926579252 2:14616604-14616626 ATGAATATACTCAAGGCCATTGG + Intergenic
926646044 2:15290754-15290776 ATGAACCTCCAGAAGGACAGAGG + Intronic
927451542 2:23213288-23213310 ATGAAGACACGGAAGCCCAGAGG - Intergenic
927645130 2:24872733-24872755 AAGAAGAGAGAAAAGGCCAGGGG + Intronic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928039718 2:27862566-27862588 CTGAAGAGACAGAAGCCCAGGGG - Intronic
928168940 2:28991179-28991201 ATGAAGAAACTGAAGCTCAGAGG + Intronic
928394920 2:30936185-30936207 ATGGAGAGACAGAAGGAAAGTGG - Intronic
929095467 2:38259500-38259522 ATGGTGACACAGAAGGACAGGGG + Intergenic
930028323 2:47043341-47043363 ATGGGGATACAGAAAGCCAGAGG + Intronic
930781502 2:55228608-55228630 AATAGGCTACAGAAGGCCAGAGG + Intronic
931836112 2:66099684-66099706 ATGAAGAAACTGAGGCCCAGAGG + Intergenic
932119625 2:69086621-69086643 ATGATTAAGCAGAAGGCCAGGGG + Intronic
932417935 2:71584926-71584948 AGAAATTTACAGAAGGCCAGAGG + Intronic
932434846 2:71697201-71697223 AAGAAGCCTCAGAAGGCCAGAGG + Intergenic
932654702 2:73600517-73600539 AGGAAGAGAAAGAAGGACAGGGG - Intronic
932799293 2:74725364-74725386 ATGAAAATACAAGAGGACAGAGG + Intergenic
933238251 2:79889566-79889588 ATGAAGAAACAGAGGCACAGAGG - Intronic
933472443 2:82742980-82743002 ATGAAGATATAGAAAGACGGAGG + Intergenic
934029382 2:88028487-88028509 ATTAAAGTACAGAAAGCCAGAGG - Exonic
935623290 2:105147112-105147134 ATGCAGATACAGAGGGTTAGGGG + Intergenic
935977020 2:108588010-108588032 ATAGAGATCCAGAGGGCCAGAGG + Intronic
937024506 2:118686851-118686873 AGGAAGATACTGAAGCCAAGCGG - Intergenic
937788112 2:125926070-125926092 ATGAAAATTCAGAAGACCAGGGG - Intergenic
939475325 2:142679511-142679533 ATGAAGAAACAGAATGCAATGGG - Intergenic
940262763 2:151799889-151799911 ATGAAGATACAGGAGAGCAAAGG + Exonic
940390146 2:153123010-153123032 GTGAAGATACAGAAGACCCAGGG + Intergenic
940390159 2:153123112-153123134 ATGAAGATACAGAAGACACAGGG + Intergenic
940848723 2:158668138-158668160 CTGGAGAGGCAGAAGGCCAGTGG - Intronic
941686901 2:168456575-168456597 ATGAAGATACAGAAGGCCAGGGG - Exonic
941843192 2:170109417-170109439 TTGAAGAAACAGAAGGGCTGTGG - Intergenic
942098889 2:172558645-172558667 ATAAGGAAACAGAAGGCAAGAGG - Intronic
942627790 2:177921723-177921745 ATGCAGATATACAAGGTCAGTGG - Intronic
943076357 2:183200358-183200380 ATGTAGAAACAGTAGGACAGTGG + Intergenic
943874705 2:193050367-193050389 ATGAAGAAACAAAAGCTCAGAGG - Intergenic
944234649 2:197430948-197430970 TTTAAAATACAGGAGGCCAGGGG - Intronic
944324546 2:198388682-198388704 ATAAACAAGCAGAAGGCCAGTGG + Intronic
945538617 2:211053617-211053639 AGGAACTGACAGAAGGCCAGTGG - Intergenic
945774466 2:214087630-214087652 AAAAAGAGACAGAAAGCCAGAGG + Intronic
946118465 2:217486213-217486235 ATGCATACACAGAAGGGCAGGGG + Intronic
946201123 2:218071368-218071390 AGGAAGATCCAAGAGGCCAGGGG - Intronic
946498307 2:220218622-220218644 AGGAAGGTTCAGAAGGTCAGAGG + Intergenic
947078780 2:226372366-226372388 AAGAAGATGCAGATGGGCAGAGG + Intergenic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
948634899 2:239328760-239328782 CTGGAGATAAAGAGGGCCAGCGG - Intronic
1169937035 20:10894739-10894761 ATGAAGAAACAAAAAGACAGAGG - Intergenic
1170128057 20:12987807-12987829 ATGAAGGTATTGAAGGCAAGAGG + Intergenic
1171469976 20:25362566-25362588 AAAAAGAGACAGAAGGGCAGGGG + Intronic
1172323475 20:34016192-34016214 ATGAAGATACAGAAACCTAAGGG - Intronic
1172413036 20:34740688-34740710 ATGGAGAGACTGAAGGCCAAGGG - Exonic
1174290107 20:49502273-49502295 AAGCAGATACGGGAGGCCAGAGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1176961421 21:15163295-15163317 GTGAAGATACAGCATTCCAGGGG + Intergenic
1180222254 21:46366372-46366394 ATGAAGCCAGAGAAGCCCAGAGG - Intronic
1181628253 22:24135743-24135765 ATGGAGAAACTGAAGGGCAGAGG + Intronic
1182250958 22:28999865-28999887 ATGTAGAGACAGAAGGAAAGGGG + Intronic
1182287576 22:29257436-29257458 GTGAAGAAACAGAAGCTCAGAGG + Intronic
1182756972 22:32688209-32688231 ATGAGGAAACTGAAGGTCAGGGG + Intronic
1183323750 22:37180469-37180491 AAGAAGAAACGGAAGGCCTGAGG + Exonic
1183848345 22:40562242-40562264 ATGACTACACAGAAGGGCAGAGG + Intronic
949873849 3:8611337-8611359 ATGAGGAGACGGAAGTCCAGAGG - Intergenic
950133380 3:10563238-10563260 ATGAGGAAACTGAAGCCCAGAGG + Intronic
950182989 3:10928043-10928065 ATGAAGACACAGAAGCACAGAGG - Intronic
950248722 3:11446107-11446129 ATGAGGATGCTGAGGGCCAGAGG - Intronic
950987061 3:17384711-17384733 ATGAAGGCACAGAAGGCAATGGG + Intronic
951589229 3:24245204-24245226 TTGATGAAACAGAGGGCCAGAGG + Intronic
953570723 3:44069308-44069330 ATGAAGACACCGAGGTCCAGAGG - Intergenic
955468013 3:59256323-59256345 ATGAAGATGCATAAGGCCCTAGG + Intergenic
955812858 3:62809391-62809413 AGGAAGAGAAAGAAGGCCTGTGG - Intronic
956013288 3:64854385-64854407 ATCAGGATGCAGATGGCCAGAGG - Intergenic
956214185 3:66831539-66831561 ATGAAGAAACTAAAGGTCAGAGG + Intergenic
956908106 3:73788160-73788182 ATAAGGATAGAGAAGGCCAGAGG + Intergenic
959089959 3:101891891-101891913 ATGAAAATATAGGAGGCTAGAGG + Intergenic
960589663 3:119353414-119353436 ATGAAGAAACTGAAGCTCAGAGG - Intronic
960720029 3:120616593-120616615 AGGCAGATACAGAAGAACAGGGG - Intergenic
961005106 3:123399907-123399929 GTAAGGAAACAGAAGGCCAGGGG + Intronic
961018682 3:123486199-123486221 ATTCAGATTCAGAAGGCCTGGGG + Intergenic
961620879 3:128223635-128223657 ATAAGGATACTGAAGCCCAGTGG - Intronic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
962982331 3:140501837-140501859 ATTCAGATTCAGAAGGCCTGGGG + Intronic
964086971 3:152830739-152830761 AGCAAGAAACAGGAGGCCAGCGG - Intergenic
964102764 3:153006656-153006678 ATGAAGAAACTGAAGGCAAGAGG - Intergenic
965597191 3:170420716-170420738 TTGAACTTTCAGAAGGCCAGAGG + Intronic
965694827 3:171397045-171397067 ATGAAGAGAAAGCAGGCAAGGGG + Intronic
966366290 3:179191153-179191175 ATGAAGAGACAGAGGTACAGGGG + Intronic
966484640 3:180454055-180454077 ATGAAGTAACTGAAGCCCAGAGG + Intergenic
966744608 3:183263687-183263709 AAGAAGGTACAGATGTCCAGGGG - Intronic
967683079 3:192387965-192387987 TTGAACATACATAAGGCCGGAGG + Intronic
967874779 3:194260501-194260523 ATGAAGAAGAAGAAGGCAAGGGG - Intergenic
968520784 4:1033849-1033871 ATGAGGACACCGAGGGCCAGAGG - Intergenic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
969841175 4:9883447-9883469 ATGAAGAAACTGAAGTCCACAGG - Intronic
970009651 4:11445266-11445288 AAAAAGAGACAGCAGGCCAGTGG - Intergenic
970128021 4:12836138-12836160 GTGAGGAAACAGAAGCCCAGAGG - Intergenic
970161735 4:13195954-13195976 AGGAATATACTGAAGGGCAGTGG - Intergenic
970478828 4:16452303-16452325 ATGAAGACACAGCAGGAAAGGGG - Intergenic
970811263 4:20096872-20096894 ATGATGATCTTGAAGGCCAGAGG + Intergenic
970859373 4:20684122-20684144 CTGAAGATAAAGAAGGCTAAGGG + Intergenic
970869151 4:20794442-20794464 ATTAACATACAGTAAGCCAGGGG - Intronic
972688190 4:41371176-41371198 ATGAAGAGAGAGAAGGAGAGAGG - Intronic
972813482 4:42616811-42616833 AAGAAGAAACAGAAGGTCAGAGG + Intronic
973596440 4:52495543-52495565 ATGAAGAGAGAGAAGTTCAGAGG + Intergenic
973719475 4:53708510-53708532 ATGAAGTTATTCAAGGCCAGAGG + Intronic
974356454 4:60819004-60819026 ATGGAGATACATAATACCAGAGG - Intergenic
974471632 4:62326171-62326193 ATGGAGAAACAGCTGGCCAGTGG - Intergenic
976514557 4:85950187-85950209 AAGAACATAAAGAAGGCCACTGG + Intronic
977612240 4:99047955-99047977 ATGGGGATAAAGAAGCCCAGGGG + Intronic
978777893 4:112521066-112521088 ATGAAAATACTGAAGGGGAGGGG - Intergenic
978986006 4:115013786-115013808 ATTATGATAGAAAAGGCCAGTGG + Intronic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979163076 4:117488761-117488783 ATGAAGAAGCAGAAGCCTAGAGG + Intergenic
979447870 4:120835994-120836016 GAGAACAAACAGAAGGCCAGAGG + Intronic
979724957 4:123949897-123949919 ATGAAGCTGCTGATGGCCAGAGG - Intergenic
979890105 4:126081765-126081787 ATGAGGATAGAGAGGGCCTGGGG + Intergenic
981124434 4:141089665-141089687 GTGAAGGTACAGAAGACCACTGG + Intronic
981540618 4:145842918-145842940 CTGAAGATACAGAAATTCAGAGG + Intronic
982717479 4:158824282-158824304 ATGAAGAACTAGGAGGCCAGAGG + Intronic
983143307 4:164180837-164180859 ATGGAGATAAAGATGGCAAGCGG - Intronic
983984388 4:174040678-174040700 AGAAACATAAAGAAGGCCAGTGG + Intergenic
984115750 4:175679178-175679200 ATTAAGACACAGAAAGACAGTGG - Intronic
985893761 5:2737422-2737444 ATGAAGCCAAGGAAGGCCAGCGG - Intergenic
986164643 5:5263403-5263425 ATGAAGAAAATGAAGACCAGAGG - Intronic
987551385 5:19386441-19386463 ATGAAGAGACAGAGAGCGAGTGG - Intergenic
988781595 5:34527518-34527540 ATGAAGAAACTGAAGTTCAGAGG - Intergenic
989455194 5:41635880-41635902 ACAAAGATACAGAAAGACAGAGG + Intergenic
992029149 5:72703145-72703167 ATTAAGATGCAGAAGGCAAATGG + Intergenic
993287995 5:86025279-86025301 ATGAAGAAAAACAAAGCCAGTGG - Intergenic
994174604 5:96697749-96697771 ATGAAGAAACTGAAGCTCAGTGG - Intronic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
995288946 5:110427228-110427250 ATGAAGAAACTGAAGAACAGAGG - Intronic
995374798 5:111461978-111462000 CTGAAGATCCAGTAGGTCAGGGG - Intronic
996954387 5:129164998-129165020 AAGAAGATACAGTAGGGGAGAGG - Intergenic
998455374 5:142268716-142268738 ATACAGAGACAGAAGGACAGGGG + Intergenic
998685660 5:144521450-144521472 ATGAAGATGTAGAAGGATAGTGG - Intergenic
998761720 5:145439649-145439671 ATGGAGATAGAGAAACCCAGAGG - Intergenic
998958082 5:147457228-147457250 ATGAAGATAAAGCAGGAAAGGGG - Intronic
999396785 5:151234622-151234644 AGGAAGATACAGATAGGCAGAGG + Intronic
999543324 5:152598519-152598541 AGGATGATACAGAAGGGCAAGGG - Intergenic
999624748 5:153508503-153508525 AAGAACAGAAAGAAGGCCAGTGG + Intronic
999686821 5:154110659-154110681 AGGAAGAGACTGAAGCCCAGCGG - Intronic
999871493 5:155756214-155756236 ATCAACATGCAGAAGGTCAGTGG + Intergenic
1000081548 5:157853052-157853074 ATAAGCATACAAAAGGCCAGAGG + Intronic
1001895563 5:175376900-175376922 AGGAAGGCACAGAAGCCCAGTGG + Intergenic
1002347406 5:178557565-178557587 AGGCAGATAAGGAAGGCCAGAGG - Intronic
1004701072 6:18080026-18080048 AAGAAGATAAAGAAGGTCAGGGG + Intergenic
1006307749 6:33234831-33234853 ATGAAAATACAGAGGGGAAGGGG + Intergenic
1007237595 6:40401928-40401950 ATGAGGACACAGAGAGCCAGGGG - Intronic
1007819990 6:44554168-44554190 ATGAAGAAACTGAAGCCCAGAGG + Intergenic
1010943378 6:81946566-81946588 ATGAAGAGAGAGGAGGACAGAGG + Intergenic
1011277720 6:85645719-85645741 ATTAAGATAGAGAAGGTCAAGGG - Intergenic
1011566216 6:88675396-88675418 ATAAAGAAAAAGCAGGCCAGGGG + Intronic
1012269080 6:97185133-97185155 ATAGGAATACAGAAGGCCAGAGG - Intronic
1012730023 6:102870272-102870294 ATGTAAATAAAGAAGGACAGCGG + Intergenic
1012730060 6:102870896-102870918 ATGTAAATAAAGAAGGACAGCGG - Intergenic
1014175139 6:118324040-118324062 ATCAAGTTACAGAAGGGTAGAGG - Intergenic
1014199611 6:118594009-118594031 AGGGACATACAGAAGTCCAGGGG - Intronic
1014260422 6:119210147-119210169 ATGAAGACAAAGATGGCGAGAGG + Intronic
1014283720 6:119470354-119470376 ATGAAGATATGCAAGGCAAGAGG + Intergenic
1014433184 6:121392935-121392957 ATGAAAATACGGAAGCACAGAGG + Intergenic
1014621244 6:123669375-123669397 AGGATGAAACAGGAGGCCAGAGG - Intergenic
1015120368 6:129694344-129694366 ATGATGAAACAGAAGCACAGAGG - Intronic
1015947056 6:138513643-138513665 GTAAAGAGACAGAGGGCCAGTGG + Intronic
1017788250 6:157774053-157774075 ATGAAGGTGCACAAGGGCAGAGG + Intronic
1018393920 6:163362448-163362470 ATTAAGATCCACAAGACCAGAGG + Intergenic
1018541154 6:164881242-164881264 ATGAAGAAACAGAACCCCACAGG + Intergenic
1018797295 6:167196349-167196371 ATGAGGGTGCAGAAGGCCACGGG - Intronic
1018819002 6:167358415-167358437 ATGAGGGTGCAGAAGGCCACGGG + Intronic
1019357643 7:589178-589200 ATGGAGAAACCGAAGACCAGAGG - Intronic
1020682539 7:11254818-11254840 ATGAGGAATCAGAAGGCAAGTGG + Intergenic
1020739314 7:11993188-11993210 ATGAAGAGACAGAAGATCAGTGG - Intergenic
1020739744 7:11999509-11999531 ATAGAGAGACAGAAGGACAGAGG + Intergenic
1023694801 7:42833986-42834008 ATGAAGATTTTGAATGCCAGAGG + Intergenic
1024095616 7:45980258-45980280 ATCAGGATACAGATGTCCAGGGG - Intergenic
1024224636 7:47316383-47316405 ATGAAGATCCTGAAGGCCCCAGG - Intronic
1024636591 7:51295675-51295697 AGGGACCTACAGAAGGCCAGAGG - Intronic
1027436188 7:78166950-78166972 ATGAAGAAACTGACGCCCAGAGG - Intronic
1027762722 7:82300247-82300269 ATAAAGATAAAGAAGGCCTGTGG + Intronic
1028349478 7:89827493-89827515 ATGAAGAAACAGCCAGCCAGTGG - Intergenic
1028668922 7:93378437-93378459 ATCAAGATACAAAGTGCCAGAGG - Intergenic
1028844925 7:95469303-95469325 ATGAGGAAACTGAAGGCCTGAGG + Intergenic
1031555978 7:123176892-123176914 ATGAAGATAGAGAAGCAAAGAGG - Intronic
1031798456 7:126209745-126209767 ATAAAAATAAAGAAGTCCAGTGG + Intergenic
1031832258 7:126642343-126642365 AAGATGATACTGTAGGCCAGGGG + Intronic
1032019898 7:128401514-128401536 AGAAAGAAAAAGAAGGCCAGGGG + Intronic
1032123480 7:129173711-129173733 ATGAAGAAAGAGAAGGCAAAGGG + Intergenic
1033266786 7:139894020-139894042 ATGAAGAAGCTGAGGGCCAGGGG + Intronic
1033297778 7:140156814-140156836 ATGGAAATAGAGAAAGCCAGGGG + Intronic
1033999077 7:147389053-147389075 AGGAAGATAGAGTAGTCCAGGGG - Intronic
1034016400 7:147591760-147591782 TTGAGGATACAGTATGCCAGTGG - Intronic
1034024681 7:147687757-147687779 AGGAAGAGAGAGAAGGCAAGGGG + Intronic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035876173 8:3191873-3191895 ATGAAGAAACACAAGGACTGAGG - Intronic
1035900804 8:3456795-3456817 ATGAGGCTACTAAAGGCCAGGGG + Intronic
1035927177 8:3740920-3740942 AAGAAGATAGAGGGGGCCAGGGG + Intronic
1036513445 8:9421749-9421771 ATGAGGATACAGAAAGCAGGTGG + Intergenic
1037945954 8:22989649-22989671 AAGAGGAAACTGAAGGCCAGAGG + Intronic
1038678563 8:29645623-29645645 ATGAAGCAACAGAAGCCCACAGG - Intergenic
1041848205 8:62356441-62356463 ATCAAGATAGAGAATGACAGGGG - Intronic
1042385591 8:68170148-68170170 AGGAAGACAGAGAAGGCCAGTGG + Intronic
1042673038 8:71285027-71285049 ATGGAGATATAGAAGACAAGAGG - Intronic
1042975765 8:74467429-74467451 ATGAAGAAAGAGAGGGCAAGGGG + Intronic
1043579306 8:81693427-81693449 ATGATAATACAGAAGTTCAGAGG - Intergenic
1043966448 8:86482853-86482875 CTGAACATACAGAAGGCCCTGGG + Intronic
1044553964 8:93542088-93542110 ATGAAGAAACAGAGGTACAGAGG + Intergenic
1044874333 8:96649377-96649399 AGGAAGAGCCAGAAGGCCACAGG + Intronic
1047057852 8:121187267-121187289 GTGGAGATACATCAGGCCAGAGG - Intergenic
1047239699 8:123074561-123074583 ATCAAGAAAGAGAAGGCGAGTGG - Intronic
1047754479 8:127908065-127908087 ATTAAGATAGAGAATGCCATGGG - Intergenic
1047963711 8:130029795-130029817 ATGAAGACACTGAAACCCAGAGG + Intergenic
1048357001 8:133661765-133661787 ATGAAGACAGAGAGGGACAGGGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048551387 8:135436691-135436713 ATGAAAATAAAGCAGGGCAGGGG + Intergenic
1048725655 8:137380618-137380640 AAGAACATAGAGAAGGCAAGAGG - Intergenic
1049209390 8:141378565-141378587 ATGAAGAACCTGAAGCCCAGAGG + Intergenic
1049606412 8:143531317-143531339 AGGAAGAAACGGAAGGCAAGGGG + Intronic
1051393096 9:16587884-16587906 ATTATGATACAGAAGTCTAGTGG - Intronic
1051623720 9:19078492-19078514 ATGACCATAAAGAAGGCCGGGGG + Intronic
1052512824 9:29443325-29443347 ATAAAGATATAAAAGGTCAGAGG - Intergenic
1055290264 9:74775481-74775503 ATGGAGTTACAGAAGGCCTTGGG - Intronic
1055434256 9:76276535-76276557 AGGAACATCAAGAAGGCCAGTGG - Intronic
1056303189 9:85263097-85263119 CTAAAGATACAGAAGCCCTGGGG + Intergenic
1057404377 9:94755631-94755653 AAGAAGATAAAGAAGGTCAAAGG + Intronic
1058040061 9:100293366-100293388 ATGAAGAAGCAGAGGGTCAGGGG - Intronic
1058570649 9:106339294-106339316 ATGAGGAGACAGAAGCTCAGTGG + Intergenic
1059502038 9:114763006-114763028 CTAAAGAAACAGCAGGCCAGGGG - Intergenic
1059714888 9:116904532-116904554 ATGAAGAAACTGAAGCCCACAGG - Intronic
1059878213 9:118659901-118659923 TGGAAGAGACAGAAGGCAAGAGG + Intergenic
1060468012 9:123924832-123924854 AGGAACGGACAGAAGGCCAGTGG - Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1061568446 9:131460282-131460304 ATCCAGATAAAGAAGGCTAGAGG - Intronic
1061624931 9:131835975-131835997 AGGAAGAGACAGAAGGCCATAGG - Intergenic
1062392422 9:136339225-136339247 ATGAATGTACAAAATGCCAGTGG + Intronic
1186230718 X:7450782-7450804 CTGAAGATGCACAAAGCCAGTGG + Intergenic
1186623560 X:11267402-11267424 ATGAGGAAACAGAAGCGCAGAGG + Intronic
1186843047 X:13504659-13504681 ATAAAGAAACTGAAGGCCAGGGG - Intergenic
1187021624 X:15388449-15388471 ATGAAGAAGCAGAAGGTCAAAGG - Intronic
1188067806 X:25682808-25682830 GTGAAGATACAGCAGGAAAGTGG - Intergenic
1188115889 X:26241865-26241887 ATAAAAATACAAAAGTCCAGGGG - Intergenic
1188522126 X:31050387-31050409 AGGAAGATAGAGAAGGCCTCAGG - Intergenic
1190021017 X:46875711-46875733 ATGAAGCTATCAAAGGCCAGTGG - Intronic
1190460008 X:50663169-50663191 TAGAAGATATAGAAAGCCAGTGG - Intronic
1190852115 X:54255284-54255306 ATGAAGATACTAAAGATCAGAGG - Intronic
1192262819 X:69517670-69517692 ATGAGGAGCCAGAAGGCAAGTGG + Intronic
1192336823 X:70228365-70228387 ATGAAAAGGCAGAAAGCCAGAGG + Intergenic
1194384069 X:93231566-93231588 AGGAAAATTGAGAAGGCCAGAGG + Intergenic
1194738135 X:97538901-97538923 ATTAAGATACAGAATCCTAGTGG - Intronic
1194853645 X:98901027-98901049 ATGAAGAAACTGAAGCCCAAAGG - Intergenic
1195133933 X:101884471-101884493 ATCAAAGTACAGAAAGCCAGAGG - Exonic
1195564455 X:106324440-106324462 ATGAAGATACTAACTGCCAGAGG - Intergenic
1197670834 X:129275046-129275068 ATGATGATACTGAAGGCCCTGGG + Intergenic
1197883421 X:131192957-131192979 ATAAAGAAACAGAAGCTCAGAGG + Intergenic
1198244328 X:134814945-134814967 ATTAAAACACAGATGGCCAGCGG + Intronic
1198440926 X:136662603-136662625 ATGAAGACACAGAGGACTAGAGG - Intergenic
1199202496 X:145108686-145108708 ATGAAGAGACTGAAGCCCAGAGG - Intergenic
1199296681 X:146167051-146167073 AGAGAGAAACAGAAGGCCAGTGG + Intergenic
1202258281 Y:22942777-22942799 AGGAAGAGACAGAAAGTCAGAGG + Intergenic
1202411271 Y:24576535-24576557 AGGAAGAGACAGAAAGTCAGAGG + Intergenic
1202459510 Y:25093537-25093559 AGGAAGAGACAGAAAGTCAGAGG - Intergenic