ID: 941688666

View in Genome Browser
Species Human (GRCh38)
Location 2:168474892-168474914
Sequence TTATTAGGAAGCCCCATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941688666_941688669 21 Left 941688666 2:168474892-168474914 CCTTGTATGGGGCTTCCTAATAA No data
Right 941688669 2:168474936-168474958 TTATGATTAAGCTATTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941688666 Original CRISPR TTATTAGGAAGCCCCATACA AGG (reversed) Intronic
No off target data available for this crispr