ID: 941695319

View in Genome Browser
Species Human (GRCh38)
Location 2:168544773-168544795
Sequence GACACTTTTGTCAGTGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941695310_941695319 20 Left 941695310 2:168544730-168544752 CCCTCTGCTTTTCCTTTTAACTG No data
Right 941695319 2:168544773-168544795 GACACTTTTGTCAGTGCACGTGG No data
941695311_941695319 19 Left 941695311 2:168544731-168544753 CCTCTGCTTTTCCTTTTAACTGT No data
Right 941695319 2:168544773-168544795 GACACTTTTGTCAGTGCACGTGG No data
941695313_941695319 8 Left 941695313 2:168544742-168544764 CCTTTTAACTGTGGCAAAATACC No data
Right 941695319 2:168544773-168544795 GACACTTTTGTCAGTGCACGTGG No data
941695309_941695319 30 Left 941695309 2:168544720-168544742 CCACATGGGACCCTCTGCTTTTC No data
Right 941695319 2:168544773-168544795 GACACTTTTGTCAGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941695319 Original CRISPR GACACTTTTGTCAGTGCACG TGG Intronic
No off target data available for this crispr