ID: 941701930

View in Genome Browser
Species Human (GRCh38)
Location 2:168613059-168613081
Sequence CAAACCTCAAAGTTCTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941701930_941701935 -5 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701935 2:168613077-168613099 GTTTGATGCCTGGGATAAAGGGG No data
941701930_941701934 -6 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701934 2:168613076-168613098 GGTTTGATGCCTGGGATAAAGGG No data
941701930_941701933 -7 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701933 2:168613075-168613097 AGGTTTGATGCCTGGGATAAAGG No data
941701930_941701939 4 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701939 2:168613086-168613108 CTGGGATAAAGGGGGGTTGAAGG No data
941701930_941701941 21 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701941 2:168613103-168613125 TGAAGGCGAAGGAAGACTCAAGG No data
941701930_941701937 -3 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701937 2:168613079-168613101 TTGATGCCTGGGATAAAGGGGGG No data
941701930_941701936 -4 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701936 2:168613078-168613100 TTTGATGCCTGGGATAAAGGGGG No data
941701930_941701943 28 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701943 2:168613110-168613132 GAAGGAAGACTCAAGGACCTGGG No data
941701930_941701940 10 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701940 2:168613092-168613114 TAAAGGGGGGTTGAAGGCGAAGG No data
941701930_941701942 27 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701942 2:168613109-168613131 CGAAGGAAGACTCAAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941701930 Original CRISPR CAAACCTCAAAGTTCTGCAT TGG (reversed) Intronic
No off target data available for this crispr