ID: 941701935

View in Genome Browser
Species Human (GRCh38)
Location 2:168613077-168613099
Sequence GTTTGATGCCTGGGATAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941701930_941701935 -5 Left 941701930 2:168613059-168613081 CCAATGCAGAACTTTGAGGTTTG No data
Right 941701935 2:168613077-168613099 GTTTGATGCCTGGGATAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941701935 Original CRISPR GTTTGATGCCTGGGATAAAG GGG Intronic
No off target data available for this crispr