ID: 941704847

View in Genome Browser
Species Human (GRCh38)
Location 2:168647104-168647126
Sequence CACTGCCCAAATCAATTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941704847_941704850 22 Left 941704847 2:168647104-168647126 CCGGTAAATTGATTTGGGCAGTG No data
Right 941704850 2:168647149-168647171 TCTTCCTATCCATGAACATAGGG No data
941704847_941704849 21 Left 941704847 2:168647104-168647126 CCGGTAAATTGATTTGGGCAGTG No data
Right 941704849 2:168647148-168647170 TTCTTCCTATCCATGAACATAGG 0: 20
1: 294
2: 980
3: 2150
4: 2754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941704847 Original CRISPR CACTGCCCAAATCAATTTAC CGG (reversed) Intronic
No off target data available for this crispr