ID: 941711168

View in Genome Browser
Species Human (GRCh38)
Location 2:168714713-168714735
Sequence CTTCTAGCTGTGTCATCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941711168_941711169 -4 Left 941711168 2:168714713-168714735 CCATATGATGACACAGCTAGAAG No data
Right 941711169 2:168714732-168714754 GAAGTCACCATCTATGAACAAGG No data
941711168_941711170 2 Left 941711168 2:168714713-168714735 CCATATGATGACACAGCTAGAAG No data
Right 941711170 2:168714738-168714760 ACCATCTATGAACAAGGAAGTGG No data
941711168_941711172 3 Left 941711168 2:168714713-168714735 CCATATGATGACACAGCTAGAAG No data
Right 941711172 2:168714739-168714761 CCATCTATGAACAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941711168 Original CRISPR CTTCTAGCTGTGTCATCATA TGG (reversed) Intronic
No off target data available for this crispr