ID: 941721486

View in Genome Browser
Species Human (GRCh38)
Location 2:168817399-168817421
Sequence GGGGTGAGGAGGAGGTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941721479_941721486 -4 Left 941721479 2:168817380-168817402 CCCACAGGGGCTACCTCAGGGGG No data
Right 941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG No data
941721481_941721486 -5 Left 941721481 2:168817381-168817403 CCACAGGGGCTACCTCAGGGGGT No data
Right 941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG No data
941721469_941721486 24 Left 941721469 2:168817352-168817374 CCTTATAGCTCAAGGGGTTTGTG No data
Right 941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941721486 Original CRISPR GGGGTGAGGAGGAGGTTAAG TGG Intronic
No off target data available for this crispr