ID: 941721897

View in Genome Browser
Species Human (GRCh38)
Location 2:168821227-168821249
Sequence ACATAAACCCTTCTGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941721897_941721899 22 Left 941721897 2:168821227-168821249 CCTGGACTCAGAAGGGTTTATGT No data
Right 941721899 2:168821272-168821294 ACAGCAGTGTGCTCTAACATCGG No data
941721897_941721901 24 Left 941721897 2:168821227-168821249 CCTGGACTCAGAAGGGTTTATGT No data
Right 941721901 2:168821274-168821296 AGCAGTGTGCTCTAACATCGGGG No data
941721897_941721900 23 Left 941721897 2:168821227-168821249 CCTGGACTCAGAAGGGTTTATGT No data
Right 941721900 2:168821273-168821295 CAGCAGTGTGCTCTAACATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941721897 Original CRISPR ACATAAACCCTTCTGAGTCC AGG (reversed) Intronic
No off target data available for this crispr