ID: 941721901

View in Genome Browser
Species Human (GRCh38)
Location 2:168821274-168821296
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941721897_941721901 24 Left 941721897 2:168821227-168821249 CCTGGACTCAGAAGGGTTTATGT No data
Right 941721901 2:168821274-168821296 AGCAGTGTGCTCTAACATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type