ID: 941722922

View in Genome Browser
Species Human (GRCh38)
Location 2:168831227-168831249
Sequence CTGTAACCTCAGATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941722920_941722922 4 Left 941722920 2:168831200-168831222 CCTGGTTCATCAGTGGCTATTTA No data
Right 941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG No data
941722919_941722922 10 Left 941722919 2:168831194-168831216 CCACTTCCTGGTTCATCAGTGGC No data
Right 941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG No data
941722917_941722922 11 Left 941722917 2:168831193-168831215 CCCACTTCCTGGTTCATCAGTGG No data
Right 941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941722922 Original CRISPR CTGTAACCTCAGATGGCAGA AGG Intronic
No off target data available for this crispr