ID: 941726237

View in Genome Browser
Species Human (GRCh38)
Location 2:168863992-168864014
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941726237_941726244 25 Left 941726237 2:168863992-168864014 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 941726244 2:168864040-168864062 TCACTGCAACCTCCGTCTCCTGG 0: 2173
1: 45272
2: 159521
3: 144158
4: 89277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941726237 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr