ID: 941726245

View in Genome Browser
Species Human (GRCh38)
Location 2:168864049-168864071
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941726245_941726251 9 Left 941726245 2:168864049-168864071 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 941726251 2:168864081-168864103 CCTCAGTCTCCCAAATAGCTGGG 0: 196
1: 8744
2: 118534
3: 332538
4: 476592
941726245_941726252 17 Left 941726245 2:168864049-168864071 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 941726252 2:168864089-168864111 TCCCAAATAGCTGGGACTACAGG 0: 1660
1: 48171
2: 172714
3: 544294
4: 474639
941726245_941726249 8 Left 941726245 2:168864049-168864071 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 941726249 2:168864080-168864102 GCCTCAGTCTCCCAAATAGCTGG 0: 140
1: 7133
2: 102695
3: 279741
4: 424201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941726245 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr