ID: 941755473

View in Genome Browser
Species Human (GRCh38)
Location 2:169181238-169181260
Sequence CTTTTAAATCATATGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941755473 Original CRISPR CTTTTAAATCATATGGATCA GGG (reversed) Intronic
900818357 1:4867796-4867818 CTCTTCAATCATATGGAAAAAGG - Intergenic
905400282 1:37697113-37697135 GTTTTAAATCATATTAGTCAAGG - Intronic
905661354 1:39728451-39728473 CTTTTAAATGATACGGAAAAGGG - Intronic
905995539 1:42378125-42378147 CTTTTAAATCCTAAAGCTCAGGG + Intergenic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
909732334 1:78909188-78909210 ATTTTAAATGTTATGGATAATGG - Intronic
910583747 1:88856552-88856574 TTTTTAAATCTTAGGGGTCAGGG - Intronic
910774971 1:90865567-90865589 CTTTTAAAGCTTTTGTATCAAGG - Intergenic
912587535 1:110780483-110780505 CTTTTAAGTCATGTTGATCATGG - Intergenic
912843040 1:113055951-113055973 CTTTTTAATCATATGTAAAATGG + Intergenic
916349780 1:163836199-163836221 CTTCTAAAGCTTATGCATCAGGG - Intergenic
918019568 1:180673470-180673492 ATTTTATATCATCTAGATCAGGG + Intronic
918024870 1:180733318-180733340 CTTTTAAATGATATGGAAGCGGG - Intronic
918038557 1:180898116-180898138 CTTTAAAAACATAGGGTTCAGGG - Intergenic
921559875 1:216644256-216644278 CTTTTACTTCATCTGGAACATGG + Intronic
922700150 1:227754509-227754531 CCTTTAAATGATATGGAAGAGGG - Intronic
923828336 1:237525233-237525255 CTTTTAAATGATGAGGATAATGG + Intronic
924031585 1:239890778-239890800 TTTTTAAATCATTTGAATCTGGG + Intronic
924136216 1:240969881-240969903 CTTTTAAATCAAATGTATCTGGG + Intronic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1064420729 10:15188296-15188318 TTTTTTAACCATATGGATTATGG + Intergenic
1065440070 10:25743906-25743928 TTTTAAAAGCATATGGAACATGG + Intergenic
1067094519 10:43290391-43290413 CTTTGAAATCATAGGCATCATGG + Intergenic
1069046867 10:63752327-63752349 CATTTAATTCATATTGTTCATGG + Intergenic
1072364427 10:94694984-94695006 CTTTATAATCAAATCGATCATGG - Exonic
1072400504 10:95094216-95094238 ATTTTAATTCATTTGGGTCATGG - Intergenic
1072771797 10:98146670-98146692 CTTTTAAATTATTTTTATCAGGG + Intronic
1073878658 10:107953737-107953759 CTTTCCAATCAAATGGATCTTGG + Intergenic
1074604638 10:114949417-114949439 CTTCTAAGTCATATAGTTCAAGG - Intronic
1076501564 10:130940672-130940694 CTTCTAAATCATTTGCATGAAGG + Intergenic
1078969563 11:16391742-16391764 CTCTTAAATCATTTGCATGAGGG - Intronic
1080042280 11:27771356-27771378 CTTTGAAATCAGATGTATCTTGG - Intergenic
1081351526 11:42058747-42058769 TTTTCTAATCCTATGGATCAGGG - Intergenic
1086564516 11:88210654-88210676 CTTTGGAATCATAAGGATCTTGG + Intergenic
1087589276 11:100165216-100165238 CTTGTAAATAATATGGTTGAAGG + Intronic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1090135972 11:124199533-124199555 CCTTTAAATGATATGGAACGGGG - Intergenic
1090158273 11:124464472-124464494 ATTTTAAATCATATGGATCTTGG + Intergenic
1091998707 12:5016103-5016125 CTTATAGATCATATAGATTAGGG - Intergenic
1094607647 12:31962795-31962817 CTTTTAAAGTTCATGGATCAGGG + Intronic
1095727730 12:45471300-45471322 CTATTAGATCATAAGGTTCATGG + Intergenic
1096019304 12:48308862-48308884 ATTTTAAGGCAAATGGATCATGG + Intergenic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1096547625 12:52351607-52351629 CTTTAAAATCACATGGATAGGGG - Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098031003 12:66253806-66253828 TTTTTAAATCTAATAGATCAAGG - Exonic
1098170303 12:67740191-67740213 CTTTTAAAATATGTGAATCATGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100722751 12:97376018-97376040 CTTTGAAATCAGATGGATTTGGG + Intergenic
1101134066 12:101721377-101721399 CTTTAAAGTCATTTGGAGCAAGG + Intronic
1101458231 12:104860133-104860155 TTTTTAAATTATATTGATCTAGG + Intronic
1102605231 12:114063311-114063333 CTTTTTAATCACATGGCTGAAGG - Intergenic
1105961489 13:25345413-25345435 CTTTTAAATCACATAGACCTAGG - Intronic
1106175708 13:27329417-27329439 CTTTGGAATCAGATGGATCTGGG + Intergenic
1107184360 13:37500186-37500208 ATTTTTCATCTTATGGATCAGGG + Intergenic
1108675873 13:52737292-52737314 TACTTAAGTCATATGGATCAGGG + Intronic
1108748705 13:53423748-53423770 CTTTTAAATCTTTTAAATCAGGG - Intergenic
1108760748 13:53560752-53560774 CTTCTAAATGATATATATCAAGG + Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1112201372 13:97279225-97279247 CTTTGAAATCAGAAGGACCAGGG + Intronic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1113042688 13:106121865-106121887 CTTGTAAAACATAAGGGTCATGG - Intergenic
1113307333 13:109092794-109092816 CTTTGACATCCTATGTATCATGG - Intronic
1113642931 13:111971176-111971198 CTTTTACATCAAATGGACAAGGG + Intergenic
1114002299 14:18270321-18270343 CTTTTAAACCATAGGCCTCAAGG + Intergenic
1116280463 14:42900179-42900201 CTTCTAAATCACATAGCTCAAGG - Intergenic
1116468302 14:45257955-45257977 CTTTTAAATCATATAAAAAAAGG + Intergenic
1116592644 14:46798871-46798893 TTTTTAGGTCATATGGCTCAGGG + Intergenic
1119079713 14:71680992-71681014 CCTTTAAATGATATGAAGCAGGG - Intronic
1119962008 14:78869372-78869394 GTTTTAAATAATCTGGATGATGG - Intronic
1120319128 14:82936543-82936565 CTTTTTAATCATATGTTTCTTGG - Intergenic
1122680839 14:103461595-103461617 CTTCTAACTGATGTGGATCATGG - Intronic
1122894562 14:104750041-104750063 GTTTTCAATCTTATGGATCGTGG - Intergenic
1123386828 15:19819522-19819544 CTTTTAAACCATAGGCCTCAAGG + Intergenic
1126433145 15:48608268-48608290 TTTTTATATGATAGGGATCAAGG - Intronic
1128849189 15:70934755-70934777 ATTTTAAATCCTTTGAATCAAGG - Intronic
1129851284 15:78795343-78795365 CTTTTATTCCATATGGAACAGGG + Intronic
1130043189 15:80423028-80423050 CTTTTAAATCAAATGTATGTTGG + Intronic
1130238315 15:82160652-82160674 TTTTTAACTAATATGGATAAAGG + Intronic
1131462206 15:92625404-92625426 CATTTAAATCAGATGAATCATGG - Intronic
1134330921 16:13250511-13250533 CCTCTATATCATATGGATAAGGG - Intergenic
1138849933 16:60615538-60615560 CTTTAAAACCATCTTGATCAGGG + Intergenic
1139365638 16:66431615-66431637 CTTTTACAAAATAAGGATCACGG + Intronic
1139721777 16:68861898-68861920 CTTTTAATTCATTTGGAACTTGG - Intronic
1140615687 16:76660371-76660393 CTTTCAAAATATATGGATTAGGG - Intergenic
1142765746 17:2063300-2063322 TTTTAAAATCATGTGGATTATGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149101398 17:52910653-52910675 AATTTAATTCATATAGATCATGG + Intergenic
1150816014 17:68392344-68392366 TTTTTAAGTCATATGGTGCAAGG - Intronic
1154535394 18:15400952-15400974 CTTTTAAACCATAGGCCTCAAGG - Intergenic
1155594715 18:27472243-27472265 GTTCTAATTCATGTGGATCATGG + Intergenic
1155896756 18:31339195-31339217 ATTTTATATCAAATGGACCATGG - Intronic
1156722858 18:40091508-40091530 TGTTTAAATCTTATGGATCCTGG + Intergenic
1157074993 18:44455693-44455715 CTTTTAGTTTATATGGATTATGG + Intergenic
1157858999 18:51124391-51124413 CCTTTAAATGATATGGAAAAGGG - Intergenic
1158542316 18:58368350-58368372 TATTTAAAGCATATAGATCATGG + Intronic
1158813524 18:61066397-61066419 CTTTACAATTATATGGATCAGGG - Intergenic
1159213952 18:65365655-65365677 CTTTTCAATGAGATGGATCCTGG + Intergenic
1159493217 18:69165641-69165663 CTTTTTAATAATATGAAACATGG + Intergenic
925560735 2:5191513-5191535 CTATTAAATTTTATGTATCATGG + Intergenic
928905947 2:36367812-36367834 CTTTTAAATCATATTCACCGTGG + Intronic
928983985 2:37162736-37162758 CTTTTAAAGCATATGATTCAGGG + Intergenic
933401379 2:81801166-81801188 CTTTTATATCAAGTGGATAAAGG - Intergenic
934472644 2:94567910-94567932 CTTTTAAACCATAGGCCTCAAGG + Intergenic
934849230 2:97686716-97686738 CTTTTAAATCAACTGAAACAGGG - Intergenic
935443346 2:103129336-103129358 CTTTTAGTTTATATGGATAACGG - Intergenic
935615341 2:105074131-105074153 CTATTAAATCCTATGGAATATGG + Intronic
935665006 2:105503557-105503579 CTCTCAAATCATAAGGACCAGGG + Intergenic
939899142 2:147828654-147828676 TTTTTAAATCATATATATAAGGG + Intergenic
941101792 2:161304667-161304689 CTTTTAAAATATATGAATAAAGG - Intergenic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
943091560 2:183381620-183381642 CCTTAAAATCATATGAATCCTGG - Intergenic
944064846 2:195608718-195608740 CATTTAAATAATATGTATGAGGG - Intronic
944786239 2:203073486-203073508 TTTTTAAATTATATTGATCCTGG + Intronic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
945231172 2:207591858-207591880 CTTTTAAATGGTTTAGATCAGGG + Intronic
945769698 2:214027541-214027563 CATTTAAATCATATTGATAAAGG + Intronic
945940685 2:215946392-215946414 CTTTCAAAGCAAAAGGATCAAGG + Intronic
945987268 2:216364950-216364972 CTTTTAAATATTTTGGAGCATGG + Intronic
1169807371 20:9573494-9573516 CATTTAACTAACATGGATCAGGG - Intronic
1170358926 20:15523172-15523194 CTTTTAAATCATATGGAGTCAGG - Intronic
1171740701 20:28882918-28882940 CTTTTCAATCATATGCCTCAAGG + Intergenic
1172804910 20:37604839-37604861 CTTTAAAATCATTTAGATCGGGG + Intergenic
1173542754 20:43866941-43866963 CTTTGGAATCATGGGGATCAGGG - Intergenic
1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG + Intergenic
1174958061 20:55123184-55123206 ATATTACATGATATGGATCAGGG - Intergenic
1176713163 21:10325833-10325855 CATTTAAAAAATATGGATCTTGG - Intergenic
1177262918 21:18752473-18752495 CTTTTGAAAGAGATGGATCATGG - Intergenic
1177468812 21:21527606-21527628 ATTTCAAATCCTATGAATCAGGG + Intronic
1179326978 21:40356654-40356676 CTTTGAAATCATATTGAGAATGG + Intronic
1180426808 22:15201112-15201134 CTTTTAAACCATAGGCCTCAAGG + Intergenic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
949710631 3:6866563-6866585 CTTCTCAATCATATATATCAAGG + Intronic
949751303 3:7355401-7355423 CTGGTGAATCATATGGACCAAGG - Intronic
950231646 3:11281233-11281255 CATTTATATCATAGGTATCATGG + Intronic
950962671 3:17122016-17122038 CATCCCAATCATATGGATCAAGG - Intergenic
951115322 3:18854436-18854458 TTTTTAAAATATACGGATCATGG + Intergenic
951201476 3:19879829-19879851 GTTTTAAAACATATAAATCATGG - Intronic
952580171 3:34824141-34824163 CTTTTAAATGATATGGAAGGGGG + Intergenic
954173296 3:48822817-48822839 CTTTTAAACAATATTGATAATGG - Intronic
955820363 3:62890087-62890109 CAGTTAAATAATATGGATAACGG - Intergenic
956311629 3:67887255-67887277 CTTTTGAATAATAAGGACCAAGG - Intergenic
956823548 3:72975591-72975613 CTTGTAGAGCATATGGGTCAAGG + Exonic
957381536 3:79436125-79436147 GTTTTTAATCCTATAGATCATGG + Intronic
957544741 3:81623051-81623073 CTTTTAAAAGGTTTGGATCAGGG - Intronic
960694587 3:120383594-120383616 CTTTGGATTCATATGGATTATGG + Intergenic
961987056 3:131146033-131146055 CTTTAAAATGTTCTGGATCAGGG + Intronic
962659109 3:137582954-137582976 GTTTTAAATCATATAGCTCATGG + Intergenic
963415591 3:144992025-144992047 ATTTAAAATCATATGGTTGAAGG - Intergenic
964155162 3:153576238-153576260 CTTTTAAATCATAAGGATAAGGG + Intergenic
965663600 3:171067880-171067902 CTTTTAACTCATGTGGATGTGGG - Intronic
966217600 3:177519471-177519493 CCTTTAAATGATATGGAAGAGGG + Intergenic
966382889 3:179361139-179361161 CTTTTAATTCATATAAATGAAGG + Intronic
968266245 3:197365726-197365748 CTTTTAAATGATAATGATGATGG + Intergenic
969068252 4:4508090-4508112 CTATTAAATAAAATGGATCATGG + Intronic
970842135 4:20486456-20486478 CTTTTAACTGATATGCATTATGG + Intronic
972674549 4:41247148-41247170 CTATAAAATCATATTAATCAAGG + Intergenic
972689238 4:41380593-41380615 ATTTAAAATGATCTGGATCAGGG + Intronic
973930103 4:55783518-55783540 CTTTGAAAACATAGGGTTCATGG + Intergenic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
978061020 4:104338614-104338636 CTTTGAATTCATCTGGTTCAGGG + Intergenic
978597707 4:110396313-110396335 CTTTTAAAGCACCTGGTTCAGGG - Intronic
978833868 4:113123720-113123742 CTTTAAAAATATATGGATTATGG - Intronic
979399753 4:120233974-120233996 CCTTAAAATTATGTGGATCATGG - Intergenic
981080267 4:140633171-140633193 TTTTTAAAGCATATGGCCCAAGG + Intronic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
982703449 4:158682373-158682395 CTTTAAAAGCACCTGGATCAAGG - Exonic
982866034 4:160512946-160512968 CTTCTGGATCATATGGCTCAAGG + Intergenic
982973176 4:162017054-162017076 GTTTTAAAAAATATGGATAAAGG + Intronic
983097616 4:163582986-163583008 TTTTTAAAGCCTATGCATCATGG + Intronic
983151514 4:164288101-164288123 ATTTTGAACCATGTGGATCATGG - Intronic
984563857 4:181303768-181303790 CTTTTAATTCATGTGGATTAGGG + Intergenic
984718487 4:182948319-182948341 TTTTTAAAACATATAGATTAGGG + Intergenic
985121577 4:186648494-186648516 ATTTTTAATGAAATGGATCACGG + Intronic
986023370 5:3825716-3825738 CTTTTAATCCATCTGGATCATGG - Intergenic
987872175 5:23634817-23634839 CTTTGCATTCATATGAATCATGG + Intergenic
988230974 5:28479161-28479183 CTTTTTTTTCACATGGATCAAGG + Intergenic
988498910 5:31767807-31767829 CTTTTAAGGAGTATGGATCAAGG - Intronic
990429446 5:55719724-55719746 CTTTTAAAACTTATTGAACAGGG + Intronic
992938605 5:81738799-81738821 TTTGGAAATCATATGGAGCATGG - Intronic
993109114 5:83633404-83633426 CTTATCCATCATAAGGATCATGG - Intergenic
993434035 5:87869302-87869324 CTTTTAAATTTTATAGTTCAAGG - Intergenic
994003262 5:94806369-94806391 CTTTTCAGTCATATGAAACAAGG + Intronic
994467539 5:100157470-100157492 AATGTAAATCATATGGATTATGG + Intergenic
994809471 5:104495653-104495675 CTTCTGAATGATATGGATAAAGG + Intergenic
995816909 5:116180260-116180282 GTATTAAATCATATCCATCAAGG - Intronic
1003012736 6:2441191-2441213 CTTTTAAATCATAGAGAAGATGG + Intergenic
1005252984 6:23968748-23968770 CTTTGAAGTGAAATGGATCAGGG - Intergenic
1005723986 6:28630982-28631004 CTTTTAAAATATATGTACCATGG - Intergenic
1005734112 6:28729648-28729670 CTTTTAAATTATGTTGATTAAGG + Intergenic
1005890565 6:30134643-30134665 CTTTGAAATCACCAGGATCATGG + Intergenic
1009301321 6:62026674-62026696 CTTTTAAATTATTGGGATTAAGG + Intronic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1014039048 6:116802895-116802917 TTTTTAAAACATATGGTTCTAGG - Intronic
1018352167 6:162971295-162971317 CATTTACAAAATATGGATCATGG + Intronic
1020701004 7:11483217-11483239 TTTTTAAAGCATATGAATAAAGG - Intronic
1020895334 7:13932094-13932116 GTTCTAAATCAATTGGATCACGG + Intronic
1021628319 7:22617134-22617156 CTCTTAAAACATAAAGATCAGGG + Intronic
1022270346 7:28801010-28801032 CTTGTAAAACATATAGAACAAGG + Intronic
1025950410 7:66140923-66140945 CTTTAAATTTATATAGATCATGG - Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1028318008 7:89427905-89427927 TTTTTAAATCATATATATCTGGG + Intergenic
1028322678 7:89479933-89479955 ATTTTAAATCATATTTCTCAAGG + Intergenic
1028835179 7:95366699-95366721 CTTTGAATTCAGATGGATCTGGG + Intronic
1029877187 7:103766659-103766681 TTTTTAAATCATTTGTATTAAGG - Intronic
1031726162 7:125242179-125242201 CTTTTAAATCAGTTGGAGGAGGG + Intergenic
1034099346 7:148437723-148437745 CTTTTAAATGATATGGAAGTGGG - Intergenic
1035033075 7:155876036-155876058 CATTTAAAACTTATAGATCAGGG - Intergenic
1035425677 7:158771119-158771141 CTTTTAAATAAAATGAATCAGGG + Intronic
1035954609 8:4062310-4062332 CTTCTAAATAATATGGTCCAGGG + Intronic
1039257195 8:35732616-35732638 GTTTTAAAGCATATGTATAATGG - Intronic
1039284241 8:36022996-36023018 CTTTTGAGTTCTATGGATCAAGG + Intergenic
1042903839 8:73753529-73753551 CTTTTAAGTCTTATGGCACATGG + Intronic
1043719196 8:83524554-83524576 CTAATAAAGCCTATGGATCAGGG + Intergenic
1045477739 8:102567741-102567763 ATTTTAATTGAAATGGATCAAGG + Intergenic
1045811250 8:106222546-106222568 ATTTTAAATAATATATATCATGG - Intergenic
1046647289 8:116800183-116800205 CTTTGAAGTCATATTGATCTGGG - Intronic
1046975424 8:120270566-120270588 CATTTAAAAAATATGTATCAAGG + Intronic
1047222808 8:122932084-122932106 CTTGTGAATCTTATGGGTCAGGG + Intronic
1047539691 8:125752673-125752695 CAATTTAATAATATGGATCATGG + Intergenic
1047810312 8:128401734-128401756 ATTTTACATCATATGGAGCCTGG - Intergenic
1048081247 8:131130148-131130170 CTTCTAAAACATAGGGTTCAGGG + Intergenic
1048240718 8:132739265-132739287 CTTTTAAATCAGATAGACCTCGG + Intronic
1049058116 8:140254815-140254837 CTTTGGAATCATTTGGATCTAGG - Intronic
1050027637 9:1352214-1352236 CTTTTAAATCAAATGGGAAAGGG + Intergenic
1050342555 9:4654960-4654982 CCTTTAAATGATATGGACCAGGG - Intronic
1050759647 9:9051810-9051832 CATTTAAATCAAATTGTTCAGGG + Intronic
1050790944 9:9468876-9468898 ATTTTTAATCATTTTGATCAGGG + Intronic
1051846274 9:21454974-21454996 CTTTTAGGTCATATAGAACAAGG + Intergenic
1052807238 9:33024451-33024473 CTTTTAAATCCTACGGGTCAGGG - Intronic
1053687058 9:40541862-40541884 CTTTTAAACCATAGGCCTCAAGG - Intergenic
1053870191 9:42483209-42483231 CTTTTACATCATATGTATTGAGG - Intergenic
1053937197 9:43172275-43172297 CTTTTAAACCATAGGCCTCAAGG - Intergenic
1054086098 9:60745940-60745962 CTTTTACATCATATGTATTGAGG + Intergenic
1054241360 9:62617177-62617199 CTTTTACATCATATGTATTGAGG + Intergenic
1054276690 9:63084336-63084358 CTTTTAAACCATAGGCCTCAAGG + Intergenic
1054398145 9:64680595-64680617 CTTTTAAACCATAGGCCTCAAGG - Intergenic
1054555488 9:66651700-66651722 CTTTTACATCATATGTATTGAGG + Intergenic
1054580449 9:66907254-66907276 CTCTAAAATCATATGTATCCTGG + Intronic
1055645704 9:78359476-78359498 CTTTTAGATTCAATGGATCAGGG - Intergenic
1056516429 9:87355449-87355471 CTTTCAAAACATATGGGTGAAGG - Intergenic
1057766510 9:97924398-97924420 CTATAATATCATATGGTTCATGG + Intergenic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1058634857 9:107028553-107028575 ATTTTAATTCACATGCATCATGG - Intergenic
1059083902 9:111279286-111279308 CTTTGAAATCATACTGATCAGGG - Intergenic
1059960930 9:119563821-119563843 TTTTTCAATCATATGAATCTAGG + Intergenic
1060653018 9:125346974-125346996 CTTTTATATCATAGTGATAAAGG + Intronic
1060896476 9:127221369-127221391 TTTTTTAAGCAAATGGATCATGG + Exonic
1186739374 X:12500921-12500943 TTTTTAAAAGATATGGATGATGG + Intronic
1187486396 X:19708201-19708223 CTTTTGAAACATATTGATCAGGG - Intronic
1188333365 X:28898174-28898196 CTTTCAAATCATATGTATAAGGG - Intronic
1189488641 X:41452365-41452387 CTTTTAAATCAAGTTGATTAAGG - Intronic
1190566900 X:51739856-51739878 ATTTTAAATCATATTGATGGTGG + Intergenic
1192004418 X:67194526-67194548 CTTGTATTTCACATGGATCATGG - Intergenic
1193183698 X:78487284-78487306 CTTTTAAATGATACGGATGCGGG - Intergenic
1193702573 X:84780589-84780611 CTTTTAAATGATATGGAAGTGGG - Intergenic
1194040502 X:88936314-88936336 CTATGAATTCATATGGTTCAGGG + Intergenic
1194807895 X:98352194-98352216 CTATTAAATATTATGGAACATGG + Intergenic
1196000982 X:110785584-110785606 TTTTTAAACAGTATGGATCAGGG - Intronic
1196070017 X:111510100-111510122 CTTTGAAATCATATTGACCTGGG - Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197655227 X:129109420-129109442 GTTTTAAAAGATAGGGATCAAGG + Intergenic
1201859181 Y:18575795-18575817 CATATAAATAATATAGATCAAGG + Intronic
1201874141 Y:18744586-18744608 CATATAAATAATATAGATCAAGG - Intronic