ID: 941757818

View in Genome Browser
Species Human (GRCh38)
Location 2:169206867-169206889
Sequence CAGTGATGCCATAAGGAGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941757813_941757818 9 Left 941757813 2:169206835-169206857 CCTATCTACCCATATGATAGAAT 0: 1
1: 0
2: 0
3: 11
4: 112
Right 941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG 0: 1
1: 0
2: 2
3: 22
4: 191
941757815_941757818 0 Left 941757815 2:169206844-169206866 CCATATGATAGAATTTTCAAAAA 0: 1
1: 0
2: 3
3: 70
4: 757
Right 941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG 0: 1
1: 0
2: 2
3: 22
4: 191
941757814_941757818 1 Left 941757814 2:169206843-169206865 CCCATATGATAGAATTTTCAAAA 0: 1
1: 0
2: 2
3: 52
4: 627
Right 941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG 0: 1
1: 0
2: 2
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941757818 Original CRISPR CAGTGATGCCATAAGGAGTT GGG Exonic
901705343 1:11069003-11069025 GGGTGATGCCATAAGGAACTCGG + Intronic
901804217 1:11727472-11727494 CAGTGCTGAGATAAGGGGTTAGG + Intergenic
904530641 1:31166572-31166594 CAGTGCTGCCATTTGGAGCTGGG - Intergenic
905093472 1:35448577-35448599 CAGTGATGCAATGAGGGGTGGGG + Intronic
906915861 1:50009030-50009052 CAGTGAGGCCATCAGGTCTTGGG - Intronic
907112240 1:51936530-51936552 GTGTGCTGCTATAAGGAGTTTGG - Intronic
907314649 1:53560611-53560633 CAGTGATGCCAACAGGACCTGGG - Intronic
907715036 1:56918648-56918670 AAGTGATGGCATGAGGAGGTGGG - Intergenic
908362847 1:63386424-63386446 CAGTGATGCCATCAGGTTCTAGG + Intronic
908799980 1:67869888-67869910 CAGAGATGTCTTAAGGAGGTAGG + Intergenic
910797318 1:91111302-91111324 CAGTGAAGCCATTAGGTCTTAGG - Intergenic
911048807 1:93651977-93651999 CAGTGAGGCCAAAAAAAGTTAGG + Intronic
911090308 1:94012230-94012252 CAGTGATTCCAGAAAGAGTGGGG - Intronic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
916379467 1:164193464-164193486 CAGTGAAGCCATCAGGTCTTAGG - Intergenic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
917724550 1:177816305-177816327 CAGTGATGATATTAGGAGGTGGG + Intergenic
922975469 1:229780069-229780091 CAGTGATGGTATTAGGAGTTGGG + Intergenic
1062971630 10:1653262-1653284 CAGTCATGGCAGAAGGACTTGGG + Intronic
1063397364 10:5702556-5702578 CAGTGAAGCTATAAGGTCTTGGG + Intronic
1065023918 10:21523809-21523831 CAGTGCTCCCAGAAGGATTTGGG - Exonic
1065620762 10:27578557-27578579 CATTGCTGCCAAAAGGAATTGGG + Intergenic
1066711585 10:38241427-38241449 CAGTGAAGCCATCAGGCCTTGGG - Intergenic
1068850414 10:61732552-61732574 CAGTTTTGCCAAAAGGATTTAGG - Intronic
1070495262 10:77015589-77015611 CAGTGATATCATAAGGCGGTTGG - Intronic
1072392705 10:95004398-95004420 CAGTGAGAACATAAGAAGTTTGG + Intergenic
1072511887 10:96135225-96135247 AAGTGAAGCCATAAGGAGATGGG + Intronic
1074564392 10:114564152-114564174 CAGGGATGCCTGGAGGAGTTTGG - Intronic
1075886535 10:125904369-125904391 CAGTGATGCCATCAGGAACTTGG - Intronic
1075886662 10:125905365-125905387 CAGTGAAGCCATCAGGAACTGGG + Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076913871 10:133408657-133408679 CAGTGAAGCCATCAGGACCTGGG + Intronic
1078240081 11:9523235-9523257 CAGTGTTGCTATAAGGTCTTAGG + Intronic
1078449905 11:11433026-11433048 CAGTAATGCCATGAGCACTTAGG + Intronic
1078608828 11:12801678-12801700 CAGTGATGCCAGAAGATGGTTGG + Intronic
1079009112 11:16813796-16813818 CAGAGATGCCACAAGCAGATAGG - Intronic
1080260540 11:30345042-30345064 CAGTGATGGTATTAGGAGGTGGG - Intergenic
1080944960 11:36961255-36961277 CAGTGAAGCCATAAGGTCTTTGG - Intergenic
1081376932 11:42370119-42370141 CAGTGAAGCCATCAGGTTTTAGG + Intergenic
1081781685 11:45717447-45717469 TAGGGGTGGCATAAGGAGTTAGG - Intergenic
1082955025 11:58861202-58861224 CAGTGAAGCCATAAGGTCCTGGG + Intronic
1082972072 11:59033908-59033930 CAGTGAAGCCATAAGGTCCTGGG + Intronic
1087963086 11:104376167-104376189 CAGTGATGACATTAGTAGGTAGG - Intergenic
1092184039 12:6465602-6465624 AAGTGATACCCTGAGGAGTTTGG - Intronic
1095212964 12:39515073-39515095 CAGTGAAGCCATAGGGTCTTAGG - Intergenic
1095903085 12:47348712-47348734 CTGTGATGACATTAGGAGGTGGG + Intergenic
1096073520 12:48788754-48788776 CAGTGTTGCCCGAGGGAGTTGGG - Intronic
1096566978 12:52490242-52490264 CAGTGGTGCCATAATGAGGATGG - Intronic
1097904875 12:64909437-64909459 CAGTGGTGCCAGAAAGACTTGGG - Intergenic
1098472476 12:70861587-70861609 CAGTCATTCCATAAGGCTTTGGG - Intronic
1100702461 12:97162998-97163020 AGGTGATGACATTAGGAGTTGGG + Intergenic
1100964415 12:99997253-99997275 CAGAGATGCCATAAGGACTATGG + Intergenic
1101016404 12:100505310-100505332 CAGTGCAGCTCTAAGGAGTTTGG - Intronic
1103393850 12:120592958-120592980 AAGTGATGGCATTAGGAGGTGGG + Intergenic
1109976669 13:69844555-69844577 CAGTAATGCTATTAGGAGGTAGG - Intronic
1111420537 13:88005208-88005230 CAGTGGTGCGGTAAGGAGGTGGG + Intergenic
1116723759 14:48534224-48534246 CAGTGATGGCAGAAGGAGTTGGG + Intergenic
1117208100 14:53465906-53465928 CAGTGATGCCATCAGGTCCTGGG + Intergenic
1119098946 14:71861894-71861916 CAGTGAGAACATAAGGTGTTTGG - Intergenic
1122106244 14:99458430-99458452 TAGGGCTGCCAGAAGGAGTTAGG + Exonic
1202871551 14_GL000225v1_random:169566-169588 CAGTGATGCCATCAGGAACTGGG + Intergenic
1126944064 15:53798596-53798618 CAGTGATGCCATCAGGTCCTGGG - Intergenic
1129497503 15:75999342-75999364 TTGTGCTGGCATAAGGAGTTGGG + Intronic
1131581421 15:93647282-93647304 CTGTGTTGATATAAGGAGTTGGG + Intergenic
1131911014 15:97201241-97201263 CAGAGATGGGCTAAGGAGTTTGG - Intergenic
1133599004 16:7320947-7320969 TATTGAAGCCATAAGAAGTTTGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138279195 16:55760347-55760369 CCGTTATGCCACAAGCAGTTGGG + Intergenic
1139765663 16:69227374-69227396 CAGTGATGCCATATAGAGTGGGG + Intronic
1143818102 17:9536348-9536370 CAGTGATGCCGTCAGGGCTTCGG - Intronic
1145113309 17:20185074-20185096 CAGTGATGCAAAAATCAGTTTGG + Intronic
1145995857 17:29104511-29104533 CTGAGATGCCATAAGGGGTAGGG + Intronic
1149526856 17:57363316-57363338 GAGTGATGTCATAAGGGGTGGGG - Intronic
1149675128 17:58453072-58453094 CAGTGAAGCCATCAGGCCTTAGG - Intronic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1149982655 17:61323658-61323680 CAGAGATGCCATATGGAGGAAGG - Intronic
1152098725 17:78288330-78288352 CAGGGATGCCACAAGAAGTCAGG + Intergenic
1155532619 18:26782467-26782489 CAATGAGGCAATAAGGACTTGGG + Intergenic
1157476140 18:48024738-48024760 GAATCATGCCAGAAGGAGTTGGG - Intergenic
1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG + Intronic
1159248358 18:65839470-65839492 AGGTGATGCCATTAGGAGGTGGG - Intronic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1163411019 19:17154536-17154558 CAGTGCCGCCATAGGGAGTGTGG + Intronic
1165361152 19:35337786-35337808 CAGTGATGCCATAGTGAGGGAGG + Exonic
1165566663 19:36735206-36735228 CAGTGAAGCCATAAGGTCCTGGG - Intronic
925914153 2:8592878-8592900 CAGGGAGGCCATGAGGAGTGCGG - Intergenic
930892568 2:56408022-56408044 CACTGAAGCCATAAGGATTCAGG - Intergenic
933993774 2:87652573-87652595 CAGTGAGGGCATTAGGAGGTGGG - Intergenic
934682574 2:96295634-96295656 CAGTGATGCCATAAGTGGCCAGG + Exonic
935098129 2:99967035-99967057 CAGTGATGTCATCAGGACATAGG - Intronic
935740668 2:106144838-106144860 CAGTGATGGTATTAGGAGGTGGG - Intronic
936300089 2:111298310-111298332 CAGTGAGGGCATTAGGAGGTGGG + Intergenic
939011293 2:136848952-136848974 CAGAGATGCCATAAAGTGCTAGG - Intronic
939098164 2:137860555-137860577 CAGTCAAGCCATTAGGAGCTCGG + Intergenic
939120580 2:138111298-138111320 CAGAGATGCCATGAGGAGATAGG - Intergenic
939453873 2:142408161-142408183 CAGTGTTGCCAGAAAGAATTGGG - Intergenic
939521131 2:143231961-143231983 GTGTGATGCCATTAGGAGGTAGG - Intronic
939755993 2:146111924-146111946 CAGTGAAGCCATAAGATTTTTGG - Intergenic
941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG + Exonic
941762365 2:169258943-169258965 AAGTGATGCCCTAGGGATTTAGG - Intronic
942815093 2:180043581-180043603 CAGTGAAGCCATATGGATCTTGG + Intergenic
944188894 2:196980193-196980215 CACTGATGCCAAAAGGAAATGGG + Intronic
945718984 2:213394834-213394856 CAGTGAAACCATATGGACTTGGG + Intronic
945935202 2:215896873-215896895 CAGTGATGGTATTAGGAGGTGGG - Intergenic
946657680 2:221965929-221965951 CAGAGCTGCCACAAGGAGCTGGG - Intergenic
947140086 2:227012530-227012552 CAGTGATCCCATAAAGGGCTAGG + Intronic
1169860578 20:10147289-10147311 CAGGGATCAGATAAGGAGTTTGG - Intergenic
1170411936 20:16101614-16101636 CAGTGCTGCCAAAAGGACTGAGG + Intergenic
1172628597 20:36363314-36363336 CAGTGAGGCCATGGGGAGTGTGG + Intronic
1172669911 20:36627782-36627804 CAGGTATGCCAGAAGGACTTGGG + Intronic
1172954990 20:38749920-38749942 CAGTCCTGCAATAAGGATTTTGG + Intronic
1174078474 20:47954483-47954505 CTGTGATGGCATCAGGAGGTGGG + Intergenic
1177090498 21:16761302-16761324 CAGTGAAGCCATAAGGTCTTTGG - Intergenic
1179219608 21:39394764-39394786 CAGTGATGGCATTAAGAATTGGG - Intronic
1179516145 21:41908442-41908464 GAGTGAGGCCAGAAGGAGTGGGG + Intronic
1181472795 22:23151275-23151297 CAGTGCTGCCATAAGGGATCAGG - Intronic
1183044963 22:35212134-35212156 CAGGGCTGCGATAATGAGTTGGG - Intergenic
1183757478 22:39782346-39782368 CAGTGAAGCCATCAGGTCTTGGG - Intronic
1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG + Intronic
949151732 3:776659-776681 CAGTGAATCCATATGGATTTGGG + Intergenic
949264493 3:2140622-2140644 AGGTGATGCTATTAGGAGTTGGG - Intronic
951460004 3:22941194-22941216 CAGTCCAGCCATAAGCAGTTGGG + Intergenic
952283475 3:31945896-31945918 GAGTAATGCCTTAAGTAGTTTGG - Intronic
955273969 3:57529349-57529371 CAGTGAAGCCATAAGGGCCTGGG + Intronic
955641566 3:61091277-61091299 CAGTGAAGCAATTAGGAGTTTGG + Intronic
955977395 3:64491609-64491631 CAGTGAGGGCCTGAGGAGTTTGG - Intergenic
957505252 3:81112227-81112249 CAGAGATGCCATCAGGTCTTGGG - Intergenic
957808142 3:85179095-85179117 CAGTGATGCATTAAGCAGCTAGG + Intronic
959444369 3:106420079-106420101 CAGGGATGCAATCAGCAGTTAGG - Intergenic
962294196 3:134166145-134166167 AAGTGATGGTATTAGGAGTTGGG + Intronic
964565338 3:158044718-158044740 CAGTGAAGCCATCAGGTCTTAGG - Intergenic
964799818 3:160543828-160543850 CTGTGATGCCAAAAGGACATGGG + Intronic
965414828 3:168380165-168380187 CAGTGAAGCCATCAGGTCTTGGG + Intergenic
966505224 3:180693087-180693109 CTCTGATGCCTTAAGGAGTGTGG - Intronic
968423709 4:506601-506623 CAGTGATGCCATATATAGTCAGG - Intronic
969368234 4:6712917-6712939 CAGTGATGATATCAGGAGATGGG - Intergenic
973196609 4:47450472-47450494 CAGTGATTCAATAAGGAGCTTGG - Intergenic
974847393 4:67367347-67367369 AAGTGATGGCATTAGGAATTGGG + Intergenic
975108409 4:70595656-70595678 CAGTTATACCACAAGGATTTAGG - Intronic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
976704146 4:88004502-88004524 AAGTGATGGTATAAGGAGCTGGG + Intergenic
977032746 4:91907300-91907322 AACTGATGCCTTAAGGAATTTGG + Intergenic
977967630 4:103171998-103172020 CAGTGATGCCATCAGGTCCTGGG - Intronic
981751205 4:148093744-148093766 CAGTGATTATATAAGAAGTTTGG + Intronic
982217565 4:153095406-153095428 CAGAGATGCCATATGGACCTGGG - Intergenic
983597519 4:169487396-169487418 AAGTGATACCATGAGGTGTTTGG + Intronic
985766738 5:1784078-1784100 CAATGATGACACAAGGAATTTGG - Intergenic
987001862 5:13668062-13668084 CAGAGATCCCATAATGAGTGGGG - Intergenic
988112803 5:26845198-26845220 GAGTGATGGTATTAGGAGTTCGG - Intergenic
990055586 5:51572780-51572802 AAGTGATGACATTAGGAGGTAGG - Intergenic
990971479 5:61511498-61511520 AGGTGATGGCATTAGGAGTTGGG + Intronic
991537307 5:67684366-67684388 CAGTGAAGCCATCAGGTCTTAGG + Intergenic
992778540 5:80108252-80108274 AAGTGATGGCATAAGGAGGTGGG + Intergenic
993196964 5:84761333-84761355 CAGTGAAGCCATTAGGTCTTGGG + Intergenic
993302281 5:86225995-86226017 CAGTGAGGTAATAAGGATTTTGG + Intergenic
994134493 5:96269781-96269803 CAGTGAAGCCATCAGGTCTTGGG - Intergenic
996663543 5:126031747-126031769 CAGTGAGAACATAAGAAGTTTGG - Intergenic
997417806 5:133742318-133742340 CAATGATGCCATCAGGGCTTTGG - Intergenic
999080188 5:148836222-148836244 CAGTGATGCTATTGGGAGGTTGG - Intergenic
999364674 5:151014442-151014464 AAGTGATGCTATTAGGAGGTGGG + Intergenic
999591989 5:153158445-153158467 CAGTGATGCCATGGGAAGTTTGG - Intergenic
1001871163 5:175157190-175157212 AAGTGATGCTATTAGGAGATGGG + Intergenic
1001926590 5:175641539-175641561 CACTGATGCCAGAAAGAGGTAGG + Intergenic
1002132312 5:177089086-177089108 CAGTAATGCTGTAAGGAGTGGGG + Intronic
1005385104 6:25278552-25278574 CAGGGAAGTCATAGGGAGTTTGG + Intergenic
1005706741 6:28462403-28462425 CATTGATGCCAGAAAGACTTAGG + Intergenic
1005715968 6:28548872-28548894 CAGTGCAGCCATAAGGTCTTGGG + Intergenic
1006365939 6:33615203-33615225 CAGAGATGCTCTAAGGAATTGGG - Intergenic
1007369123 6:41414650-41414672 CAGTGAGGCAATAAGGTCTTCGG - Intergenic
1007488694 6:42200869-42200891 CACTGATTCTAGAAGGAGTTTGG - Intergenic
1010290585 6:74132403-74132425 CAGTGATGGTATCAGGAGGTGGG + Intergenic
1010638777 6:78295588-78295610 CAGTGAAGCCATCAGGTCTTGGG - Intergenic
1010692669 6:78929122-78929144 CAGTGAAGCCATCAGGTGTCAGG + Intronic
1013913329 6:115304583-115304605 CAGTGAAGCCATCAGGTATTAGG + Intergenic
1014508840 6:122294985-122295007 CAGTGAGGTCATAAGGGGTCTGG - Intergenic
1014613698 6:123576654-123576676 AGGTGATGGCATTAGGAGTTGGG - Intronic
1015089781 6:129341639-129341661 CAATTATGCAATAAGGAGTTAGG - Intronic
1017594748 6:156016322-156016344 AAGTGATGCCATAAAGAGCATGG - Intergenic
1018593946 6:165458304-165458326 CTGTGATGCAATCAGGAGGTGGG + Intronic
1020620414 7:10510996-10511018 CAGTGAAGCTATAAGGTCTTGGG + Intergenic
1031677146 7:124624424-124624446 CAGTGAAGCCATAAGGTCCTGGG - Intergenic
1031808232 7:126333525-126333547 TGGTGATGCCATCAGGAGTTAGG - Intergenic
1032995269 7:137439236-137439258 CATTGATGCCTCAAAGAGTTTGG + Intronic
1033882169 7:145898808-145898830 CAGTGAAGCCATCAGGTCTTAGG + Intergenic
1035127772 7:156621316-156621338 CAGTGAAGCCATCAGGTCTTGGG + Intergenic
1037623125 8:20584485-20584507 CAGAGATGCCACCAGGGGTTGGG + Intergenic
1038993701 8:32898155-32898177 GAGTGATACCATAAGAAGGTGGG + Intergenic
1039120843 8:34144592-34144614 CAGTTCTGCCATAAGGAGTGGGG + Intergenic
1039173484 8:34776790-34776812 CAGTGAAGCCATCAGGTGCTGGG - Intergenic
1040104701 8:43535060-43535082 CAGTGATGGCCTAATGAGTGAGG + Intergenic
1040750066 8:50694467-50694489 CAGTGAGGCCATCAGGCCTTGGG - Intronic
1041082380 8:54225903-54225925 CATTGATGAAATAAGAAGTTTGG - Intergenic
1043308469 8:78827593-78827615 CAGTGATGCCATTAGGTTCTGGG - Intergenic
1044188909 8:89290353-89290375 CAGTGAAGCCATAAGGTCCTGGG - Intergenic
1050311660 9:4359344-4359366 CAGTGATTCCAAAAGCAGTTTGG - Intergenic
1050949157 9:11566377-11566399 CAGAGATGCCATCAGGAGTTAGG + Intergenic
1052400606 9:27995270-27995292 CAGTGATGCCATCAGGGCCTGGG - Intronic
1057052474 9:91936028-91936050 CAGTGCTGCGGTCAGGAGTTGGG - Intronic
1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG + Intergenic
1060368188 9:123041644-123041666 CAGTGATGCCAGCAGAATTTTGG + Intronic
1203732897 Un_GL000216v2:107033-107055 CAGTGATGCCATCAGGAACTGGG - Intergenic
1203733015 Un_GL000216v2:108002-108024 CAGTGAAGCCATCAGGAACTGGG + Intergenic
1187394623 X:18908501-18908523 CAATGATGACATTAGGAGGTGGG + Intronic
1187729220 X:22235637-22235659 ATGTGATGGCATTAGGAGTTGGG - Intronic
1190880918 X:54492134-54492156 CAGTGATCCAACAAGGACTTCGG + Intronic
1191792004 X:64981007-64981029 TAGTGGAGACATAAGGAGTTGGG + Intronic
1192788779 X:74359383-74359405 CAGTGAAGCCATTAGGTCTTGGG - Intergenic
1193616641 X:83696167-83696189 CAGTGAGGCCATCAGGTCTTGGG + Intergenic
1194888074 X:99343295-99343317 CAGTGATGCCATCAGGTCTCGGG + Intergenic
1195169601 X:102253107-102253129 AGGTGATGCCATTAGGAGGTGGG - Intergenic
1195189256 X:102433992-102434014 AGGTGATGCCATTAGGAGGTGGG + Intronic
1196970730 X:121105656-121105678 CAGTCAGGCTATAAGGAGTCTGG - Intergenic
1199104311 X:143844190-143844212 CAGTGATGCCATTAGGTCCTGGG + Intergenic
1199195241 X:145021323-145021345 CAGTGAAGCCATTGGGTGTTGGG - Intergenic
1199309043 X:146301174-146301196 CAGTGGGGAAATAAGGAGTTAGG + Intergenic
1202628053 Y:56880637-56880659 CAGTGATGCCATCAGGAACTGGG + Intergenic