ID: 941760738

View in Genome Browser
Species Human (GRCh38)
Location 2:169239999-169240021
Sequence CTATTGGGTTGTAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941760738_941760743 11 Left 941760738 2:169239999-169240021 CCTTCTTCACTACAACCCAATAG No data
Right 941760743 2:169240033-169240055 TTAATGCAATGAGAACCCTTGGG No data
941760738_941760742 10 Left 941760738 2:169239999-169240021 CCTTCTTCACTACAACCCAATAG No data
Right 941760742 2:169240032-169240054 TTTAATGCAATGAGAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941760738 Original CRISPR CTATTGGGTTGTAGTGAAGA AGG (reversed) Intronic
No off target data available for this crispr