ID: 941760738 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:169239999-169240021 |
| Sequence | CTATTGGGTTGTAGTGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941760738_941760743 | 11 | Left | 941760738 | 2:169239999-169240021 | CCTTCTTCACTACAACCCAATAG | No data | ||
| Right | 941760743 | 2:169240033-169240055 | TTAATGCAATGAGAACCCTTGGG | No data | ||||
| 941760738_941760742 | 10 | Left | 941760738 | 2:169239999-169240021 | CCTTCTTCACTACAACCCAATAG | No data | ||
| Right | 941760742 | 2:169240032-169240054 | TTTAATGCAATGAGAACCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941760738 | Original CRISPR | CTATTGGGTTGTAGTGAAGA AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||