ID: 941765545

View in Genome Browser
Species Human (GRCh38)
Location 2:169292569-169292591
Sequence CAGGAAATGAACTCAGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941765545 Original CRISPR CAGGAAATGAACTCAGGTGC CGG Intronic
900030654 1:370107-370129 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
900051260 1:598778-598800 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
900172996 1:1279370-1279392 CAGGAAATGCACATAGGAGCTGG - Intergenic
901199529 1:7458664-7458686 CAGGTTATGAAGTCAGGTGCCGG - Intronic
903542578 1:24105263-24105285 CAGGAAATGGAGTCAGGACCAGG + Intronic
907585361 1:55612063-55612085 TAGCAAATGACCTCAGGGGCAGG - Intergenic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
910143234 1:84050446-84050468 CAGGAAATAGAATCAGGTGATGG - Intergenic
913485413 1:119328906-119328928 CAGGTAGTGAAGTCAGGTGTGGG - Intergenic
916704500 1:167334476-167334498 CAGGAAATAAAGTCAGGTTTAGG + Intronic
920692822 1:208159803-208159825 CAGGAACTGAAGCCAGGGGCTGG + Intronic
922349664 1:224724814-224724836 CAGGAAACCAACTCTGGTTCTGG + Intronic
922418129 1:225440456-225440478 CAGGAAAATAACTCAGGTGGAGG + Intergenic
923550727 1:234960857-234960879 CAGGAAGTGAACTCGGGGTCCGG - Intergenic
1064501393 10:15977291-15977313 TAGGAAATGAACTCAGGTTATGG - Intergenic
1065433868 10:25686649-25686671 CAGTAAATTAACTCAGGAGTGGG - Intergenic
1069483812 10:68807821-68807843 CAGGAGATGAACCCAGGAGATGG + Intergenic
1070704338 10:78626864-78626886 CTGGAATTGACCTAAGGTGCAGG - Intergenic
1071404181 10:85313306-85313328 CAGGTAATGAACTCAAGTAGAGG + Intergenic
1071736900 10:88311001-88311023 CAGGAGAGGAACTTAGGGGCAGG - Intronic
1072646734 10:97261753-97261775 CAGGAAAAATACTCAGGGGCAGG + Intronic
1072911685 10:99507561-99507583 GAGGAAATGAAGTCATCTGCAGG + Intergenic
1075815094 10:125258993-125259015 CAGGACTTGAACCCAGGTGTTGG - Intergenic
1077661626 11:4073791-4073813 TAGGAAAGGAACTCAGGGCCTGG + Intronic
1080714645 11:34788653-34788675 CAGGACTTGAACTCAGGTACTGG - Intergenic
1080805180 11:35646652-35646674 CAGGATTTGAACCCAGGAGCAGG + Intergenic
1080933568 11:36838591-36838613 CAGGACATGAACTCTTGTTCCGG + Intergenic
1082021746 11:47539906-47539928 CAGGACATAAAATCAGATGCTGG - Intronic
1082742118 11:56922524-56922546 GAGGAAATGAAATCATGTTCAGG + Intergenic
1084991462 11:72929402-72929424 CAGAAAATGAGTTCATGTGCAGG - Intronic
1085803364 11:79611954-79611976 CAAGAAGTGAACTTAGTTGCTGG + Intergenic
1087668066 11:101072940-101072962 CAGGACTTGAACTCAGGCTCTGG + Intronic
1087965289 11:104405121-104405143 GAGGACCTGAACTCAGGAGCTGG - Intergenic
1089007493 11:115104809-115104831 CAGGACTTGAACCCAGGTGTGGG + Intergenic
1089068298 11:115678983-115679005 CATGCAATGGACTGAGGTGCTGG + Intergenic
1090279861 11:125446301-125446323 CAGGATTTGAACTCAGGCCCCGG - Intronic
1090701128 11:129296554-129296576 CATGAAATGGACTCAGGGTCCGG - Intergenic
1091641742 12:2242241-2242263 CAAGAAAGGTACACAGGTGCAGG + Intronic
1094179316 12:27574721-27574743 TAAGAAATGAGCTCAGGAGCTGG + Intronic
1095925062 12:47570138-47570160 CAAGAAACTAACTCAGGAGCTGG - Intergenic
1097818006 12:64097273-64097295 CATGATATTAACTCAGTTGCTGG + Exonic
1101673435 12:106897297-106897319 CAGTCAATGAGCTCATGTGCGGG - Intergenic
1101871121 12:108566316-108566338 CAGGAACTGTCCTCAGGTGAAGG + Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1103168161 12:118788813-118788835 CAGGCAAAGAAGTCAGGCGCTGG - Intergenic
1104042735 12:125141089-125141111 GAGGAAGTGAACTCAGGTTCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104932584 12:132347650-132347672 CATGAAATGAACTCAGCAGCGGG - Intergenic
1105639753 13:22250082-22250104 CACGACAAGAACTCAGGTGCTGG + Intergenic
1107409255 13:40143397-40143419 CAGCAGATGAGCTCAGGAGCAGG + Intergenic
1107675094 13:42787599-42787621 CAGGAAATGCTTTCAGTTGCTGG + Intronic
1110372406 13:74754709-74754731 CAAGAGATGAACTCAGGAGGCGG + Intergenic
1111089484 13:83424577-83424599 CAGGGAAGGAAATGAGGTGCAGG - Intergenic
1111168311 13:84491808-84491830 CTGGACAAGAACTCAGGTACCGG + Intergenic
1111670216 13:91320627-91320649 CAGGACATGATCCTAGGTGCAGG - Intergenic
1112102471 13:96204469-96204491 CAGGACCTGAACTCAGGTCTGGG + Intronic
1113863538 13:113506688-113506710 CAGGAGAGGAACACAGGTCCAGG - Intronic
1120316304 14:82898042-82898064 CAGGAAAATCACTCAAGTGCAGG + Intergenic
1121083476 14:91127347-91127369 CAGAAAATGGACTAAGGTCCTGG - Intronic
1121473851 14:94175577-94175599 AAGGAAATAAACTCCGGGGCTGG - Intronic
1121479857 14:94257114-94257136 AAAGAAATGCACTCAGGAGCAGG - Intronic
1126504112 15:49383337-49383359 CAGGAAGTGAACACAGGTGTTGG - Intronic
1127105388 15:55608333-55608355 CAGGAATTGAACAAAGTTGCAGG - Intergenic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1128317601 15:66671073-66671095 CAGGAAAAGGACTCAGGGGAGGG - Intronic
1128461295 15:67869787-67869809 CAGGACAAGAACTCAGGAACAGG - Intergenic
1131153579 15:90061831-90061853 CAGGAAATGGAGACAGGTGGAGG + Intronic
1132285477 15:100659094-100659116 CAGCAACCGAACTCAGGTGCCGG - Intergenic
1133755839 16:8761743-8761765 CTGGAGATGCACTCAGGTGGTGG + Intronic
1134067664 16:11239594-11239616 CAGAAAATGAACTAAGGGCCAGG - Intergenic
1138178231 16:54923052-54923074 CAGGAAAAGAACCCCTGTGCAGG + Intergenic
1140777395 16:78262664-78262686 CAGGACAGGAACTCAGGAGGAGG + Intronic
1141582658 16:85011106-85011128 CTGGAAGGGAAGTCAGGTGCGGG + Intronic
1141860386 16:86712344-86712366 CAGGTAATGCACCCAGCTGCGGG - Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1144435228 17:15234021-15234043 CAGAAAATGGATTCAGGGGCAGG + Intronic
1145037835 17:19553518-19553540 AAAGAAATGAATTCAGGTGGTGG - Intronic
1146828441 17:36045531-36045553 CAGCTACTGAAGTCAGGTGCAGG - Intergenic
1147510054 17:41060168-41060190 CAGGAAATGACCTCATGTCCTGG - Intergenic
1148858115 17:50590281-50590303 GAGGAAATGCACCCAGGGGCAGG - Intronic
1148911822 17:50947023-50947045 CAGTCAATGAACTCAGGGTCTGG + Intergenic
1149550297 17:57534755-57534777 CAGGAAATGAAGTGAGGGACAGG - Intronic
1151323196 17:73363857-73363879 CAGGAGATCCAGTCAGGTGCAGG - Intronic
1153093322 18:1372795-1372817 CAGGAAATGGACCCAGGGCCAGG + Intergenic
1153413595 18:4821416-4821438 CAGTTACTGAACTCAGCTGCAGG - Intergenic
1153772357 18:8426087-8426109 CAGGGGATGAGCTCAGCTGCTGG - Intergenic
1155437337 18:25826985-25827007 GAGGAAATGAAGCAAGGTGCTGG + Intergenic
1155811142 18:30236715-30236737 CTGGAAATGGCTTCAGGTGCAGG - Intergenic
1156258562 18:35422995-35423017 CAGGCACTGAGCTCAGGTGAGGG - Intergenic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
1156918437 18:42489000-42489022 GAGGAAATGAACTCAGATGGTGG - Intergenic
1157117628 18:44876775-44876797 CAGGGAATGACCACAGGTGTGGG - Intronic
1159982814 18:74806658-74806680 CAGGATTTAAACTCAGGTACTGG - Intronic
1161054675 19:2184403-2184425 CAGGACCTGACCTCAGGTCCGGG - Intronic
1161884859 19:6986609-6986631 AAGGAAAGAAACACAGGTGCCGG - Intergenic
1163060189 19:14755131-14755153 CAGGAACAGAACACAGGTGTGGG + Intronic
1163570072 19:18076052-18076074 CAGGACTTGAACTGAGGGGCAGG - Intronic
1165342824 19:35224836-35224858 CAGGAGAAGCACACAGGTGCTGG - Exonic
1167747752 19:51362736-51362758 CAGGAAGTGGACGCAGGCGCTGG + Intronic
1168361688 19:55746112-55746134 CATGAAATGCACTCAGCTGTAGG - Intergenic
925332516 2:3069841-3069863 CATGAAATGAACTGAGTTCCTGG + Intergenic
925378485 2:3406272-3406294 CAGGAAATTATCTTAGGTGTAGG + Intronic
925572794 2:5329999-5330021 TCTGGAATGAACTCAGGTGCTGG - Intergenic
926690418 2:15729360-15729382 CAGGAAAGGGACACAGGAGCTGG + Intronic
929548813 2:42875967-42875989 CAGGGCATCAACTCAAGTGCAGG + Intergenic
930042946 2:47142928-47142950 CAGGAGATGAACCCAGGAGGTGG - Intronic
930764749 2:55073869-55073891 CAGAAACTGAGCTCAGGTCCTGG - Intronic
931402487 2:61943868-61943890 CAGGAAATGCATACAGGAGCTGG - Intronic
939224639 2:139349373-139349395 CAGTCAATGAATTCAGGAGCTGG - Intergenic
941151785 2:161923520-161923542 AAGGACATGAACTCAGAAGCTGG + Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
942910096 2:181232889-181232911 CAGGAACTGTACTCAAGTGTTGG - Intergenic
943707831 2:191054506-191054528 AAGGAAATGAAGTCCAGTGCTGG - Exonic
946141758 2:217697209-217697231 CAGGAAATGAAAGTAGGGGCAGG + Intronic
946332336 2:219017590-219017612 CAGGAGATCATCTGAGGTGCAGG - Intronic
947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG + Intergenic
948109912 2:235446075-235446097 AACGAAATAAACTCAGGGGCTGG - Intergenic
1168804619 20:665119-665141 AAGGAAATGAACAAAGGTGGGGG + Intronic
1170028815 20:11922723-11922745 CAGGAAATTAACACAGGCTCTGG - Exonic
1170598652 20:17824048-17824070 CAGGAAATGCTCTCAAGTTCAGG - Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1173367588 20:42401042-42401064 CAGGACAGGAACACAGGAGCAGG + Intronic
1173628421 20:44491118-44491140 CTGGAAATGAACACAAGGGCAGG + Exonic
1173823736 20:46034390-46034412 CAGGAAAGCAACCCAAGTGCAGG - Intronic
1174764121 20:53235468-53235490 CAGGATATGAACTCAAGTCCTGG - Intronic
1175054800 20:56188524-56188546 CAGGAAATGATTTGAGGTTCTGG - Intergenic
1178156561 21:29860480-29860502 CAGGAAGGGAGCTCAGGTGAGGG - Intronic
1179105360 21:38395718-38395740 CAGGAAATCGACACAGTTGCTGG - Intronic
1180176938 21:46095445-46095467 CAGGAAATTAGCTCAAGTCCAGG + Intergenic
1181342996 22:22197988-22198010 CAGGAAATGACCTGAGGAGGAGG - Intergenic
1181914767 22:26270900-26270922 CATGAAATGAATGCAGGGGCTGG - Intronic
1182994481 22:34800141-34800163 CAGTTAATGAAATCCGGTGCTGG + Intergenic
1184856332 22:47148684-47148706 CAGGAGAGGAACTCAGGGGAGGG - Intronic
1185275619 22:49949175-49949197 CAGGACAGGCACTCAGGTGGTGG + Intergenic
949356645 3:3187980-3188002 CAGGAATGGATCTCAGGTCCAGG - Intergenic
949446946 3:4145104-4145126 CAGGAGATGAACCCAGGAGGCGG + Intronic
950329235 3:12143130-12143152 CAGGGTAGGAACTCAGGGGCTGG + Intronic
950677842 3:14565331-14565353 CAGGGCTTGAACTCAAGTGCTGG + Intergenic
951336936 3:21434786-21434808 CAGAAAAAGATCTCAGATGCAGG + Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
955089307 3:55733627-55733649 TGAGAAATGAACTCTGGTGCAGG + Intronic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
959062077 3:101625061-101625083 CAGGACAAGAACTCAGGAACTGG - Intergenic
960044597 3:113184571-113184593 CAGGATTTGAACTCAGGTCTAGG - Intergenic
961033335 3:123625180-123625202 GAGGAAATGCTCCCAGGTGCAGG - Intronic
962231407 3:133668706-133668728 CATGCAATGAACACAGATGCTGG - Intergenic
963858460 3:150280820-150280842 CCAGAAAAGAACTCAGGTGTGGG + Intergenic
964292809 3:155200088-155200110 CAGAAAATTATCTCAGGTTCTGG - Intergenic
964393009 3:156216870-156216892 GATGGAAAGAACTCAGGTGCTGG - Intronic
966175382 3:177132797-177132819 CAGGAAATTAAATCAGAGGCAGG + Intronic
966449444 3:180041213-180041235 AGGGAAATGAACTCAGCTCCAGG + Intergenic
967200617 3:187069463-187069485 CAGGAAATGGCCTGAGGTCCAGG + Intronic
969497863 4:7536224-7536246 CAGACAAGGAACTGAGGTGCAGG - Intronic
971101801 4:23474947-23474969 CATGACATGCACTGAGGTGCAGG + Intergenic
972145065 4:36013650-36013672 CAGGAAATGACCTCATATGAAGG + Intronic
973094614 4:46180617-46180639 CAAGAAGGGAGCTCAGGTGCTGG - Intergenic
973573219 4:52261306-52261328 CAGGAAAAGAGCTCAGCTTCGGG - Intergenic
974240735 4:59243133-59243155 AAGGAAGTGCTCTCAGGTGCAGG + Intergenic
976031333 4:80758132-80758154 CTGGACAAGAACTCAGGTCCAGG - Intronic
978003504 4:103586670-103586692 AAGGACATGAATTCAGCTGCTGG + Exonic
980159972 4:129149146-129149168 CAGTAACTGAACACAGGTTCAGG - Intergenic
981487181 4:145299756-145299778 CAGGAACTCAACTCATGTGGTGG - Intergenic
981781408 4:148435207-148435229 GAGGAAAGGAACTCAGGTGTTGG + Exonic
981855538 4:149286316-149286338 CAAGAAATGATCACAGTTGCAGG + Intergenic
981929453 4:150174076-150174098 CAGGAAATGAACTCCGGGAATGG + Intronic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982603023 4:157475373-157475395 TGGGACAAGAACTCAGGTGCTGG + Intergenic
983981712 4:174005685-174005707 CAAGATAGGAACTCAGTTGCAGG - Intergenic
984456071 4:179970785-179970807 AAGAAAGTGATCTCAGGTGCAGG - Intergenic
984910378 4:184668741-184668763 CAGGAAATGACCTCAGGAAGTGG - Intronic
985145772 4:186893220-186893242 CTGGCAATGAACTCAGAGGCAGG - Intergenic
988606112 5:32679763-32679785 CAGGAACTGCGCTCAGGTGAAGG + Intergenic
992022975 5:72643156-72643178 CTGGTAAGGAACTCAGGTTCTGG + Intergenic
994825509 5:104708951-104708973 CAGGAAATGATCTCAGGTTTAGG + Intergenic
997213848 5:132094588-132094610 CAGGAACTGTACTCAGGTCCAGG + Intergenic
1001271618 5:170316638-170316660 CAGGAAATAAACTGGTGTGCAGG - Intergenic
1002743167 5:181448761-181448783 CAGGAAAGGGTCACAGGTGCAGG + Intergenic
1003384037 6:5650885-5650907 CAGAAAGTGAACTCAGGATCAGG - Intronic
1004529058 6:16436707-16436729 CAGGAAATGAAGTCAGAGGGTGG + Intronic
1005613875 6:27554024-27554046 CAGGAAAAGAACTCACGGGCCGG - Intergenic
1010346372 6:74815450-74815472 CTAGACAAGAACTCAGGTGCAGG - Intergenic
1011855247 6:91681903-91681925 CAAGAGATGGACTCAGGTCCAGG + Intergenic
1012104795 6:95143424-95143446 CAAAAAATGAACTCAGGTAAAGG + Intergenic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1017963517 6:159243907-159243929 CAGGAAGTGAACTCATTTGCTGG + Intronic
1020003113 7:4766721-4766743 CAGAAAATGGACCCAGGAGCCGG - Exonic
1021165834 7:17339377-17339399 CAGGATGTGAACTCATTTGCTGG + Exonic
1021248884 7:18299093-18299115 CAGTAAATAACCTCAGGTGTAGG + Intronic
1025982726 7:66420259-66420281 GAGGACATGAACTCTGGAGCTGG - Intronic
1028362553 7:89986577-89986599 AAGGAAATGAACTCTGTTGAAGG + Intergenic
1029895675 7:103981264-103981286 CAGGAAATAAAGTTAGGTGAAGG + Intronic
1031028639 7:116710963-116710985 CAGGGTATTAACTAAGGTGCTGG - Intronic
1031873386 7:127111420-127111442 CAGGAAATGTAGTCACGTTCTGG - Intronic
1031953379 7:127915412-127915434 CAGTAAAAGAACTCAGGAGAGGG - Intronic
1032399829 7:131617044-131617066 CAGGAACTGACCTCAGGAGCTGG + Intergenic
1032869030 7:135960942-135960964 CAGTAAACAAACTGAGGTGCAGG + Intronic
1034997309 7:155586324-155586346 AAGGAAATGTAATCAAGTGCAGG - Intergenic
1035499828 8:83538-83560 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
1037962024 8:23104982-23105004 CAGGAACTGAACTCAGCTCCAGG - Intronic
1037969430 8:23161427-23161449 CAGGAACTGAGCTCAGCTCCAGG + Intronic
1038399047 8:27269190-27269212 CTGGCAATGAACTTAGGTTCAGG - Intergenic
1039101602 8:33947484-33947506 CAGGAATTGCAATCAGGTACTGG + Intergenic
1040429372 8:47323380-47323402 CCAGAAATAAACTCAGGTGGTGG - Intronic
1040561273 8:48525235-48525257 AAGGAAAGTAATTCAGGTGCAGG - Intergenic
1040932536 8:52750052-52750074 AATGAAATGGACTCAGGTTCAGG - Intergenic
1043406540 8:79940398-79940420 CAGGAAATGAAGTATGGTGAGGG + Intronic
1043475911 8:80606068-80606090 CATGAAGGGAACACAGGTGCAGG + Intergenic
1043543233 8:81286719-81286741 CAGGAAATGAAATCAGGAGGGGG - Intergenic
1043967798 8:86498468-86498490 CAGGTCATTAACTCAGGTGAAGG + Intronic
1047516778 8:125561967-125561989 CAGGAACGGAACTCAGGTATTGG - Intergenic
1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG + Intergenic
1049726047 8:144147067-144147089 CCGGGAATGGACTCAGGTGCAGG - Intergenic
1049973425 9:841034-841056 GAGCAAATGAAGACAGGTGCAGG + Intergenic
1052805057 9:33005728-33005750 CAGAAAATGAACTCAAGGCCAGG - Intronic
1055605773 9:77968922-77968944 CAGCAAATGCACCCAGGTGAGGG + Intronic
1057004714 9:91547060-91547082 CAGGAAAAGGAGTCAGGGGCAGG + Intergenic
1059467208 9:114476536-114476558 GAGGAAGTGAAATCAGGAGCCGG - Intronic
1059597890 9:115743096-115743118 CAGGATCCAAACTCAGGTGCAGG + Intergenic
1060618857 9:125044623-125044645 CAGGACAAGAACTCAGGACCTGG + Intronic
1061210026 9:129186067-129186089 CAGGAAATAAACTAAGGAGAGGG - Intergenic
1203609050 Un_KI270748v1:79796-79818 CAGGAAAGGGTCACAGGTGCAGG + Intergenic
1186912026 X:14178211-14178233 CAGCTAATGAAAACAGGTGCAGG - Intergenic
1190214205 X:48469153-48469175 CAGGAAGTGAATTCAGGTGTGGG - Intronic
1190581219 X:51894311-51894333 CAGAAAATGGACTGTGGTGCGGG + Exonic
1192341753 X:70268814-70268836 CATGAGGTGAACTCAGGTTCAGG + Intronic
1193865512 X:86726014-86726036 AAGGTAATGACTTCAGGTGCTGG + Intronic