ID: 941768336

View in Genome Browser
Species Human (GRCh38)
Location 2:169323761-169323783
Sequence GATTACTTCTTGGCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941768336_941768338 18 Left 941768336 2:169323761-169323783 CCAGTTTTAGCCAAGAAGTAATC No data
Right 941768338 2:169323802-169323824 GTAACTTTAAAACATTCTCCAGG No data
941768336_941768339 29 Left 941768336 2:169323761-169323783 CCAGTTTTAGCCAAGAAGTAATC No data
Right 941768339 2:169323813-169323835 ACATTCTCCAGGAGCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941768336 Original CRISPR GATTACTTCTTGGCTAAAAC TGG (reversed) Intronic
No off target data available for this crispr