ID: 941771450

View in Genome Browser
Species Human (GRCh38)
Location 2:169350003-169350025
Sequence TCTTGCCTCGACGATTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941771450_941771457 18 Left 941771450 2:169350003-169350025 CCATTGCAATCGTCGAGGCAAGA No data
Right 941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG No data
941771450_941771456 3 Left 941771450 2:169350003-169350025 CCATTGCAATCGTCGAGGCAAGA No data
Right 941771456 2:169350029-169350051 GGCAGTCGGTTGAATCAGGGTGG No data
941771450_941771455 0 Left 941771450 2:169350003-169350025 CCATTGCAATCGTCGAGGCAAGA No data
Right 941771455 2:169350026-169350048 GAGGGCAGTCGGTTGAATCAGGG No data
941771450_941771454 -1 Left 941771450 2:169350003-169350025 CCATTGCAATCGTCGAGGCAAGA No data
Right 941771454 2:169350025-169350047 AGAGGGCAGTCGGTTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941771450 Original CRISPR TCTTGCCTCGACGATTGCAA TGG (reversed) Intronic
No off target data available for this crispr