ID: 941771457

View in Genome Browser
Species Human (GRCh38)
Location 2:169350044-169350066
Sequence CAGGGTGGCAGAAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941771450_941771457 18 Left 941771450 2:169350003-169350025 CCATTGCAATCGTCGAGGCAAGA No data
Right 941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941771457 Original CRISPR CAGGGTGGCAGAAGTGAAGA TGG Intronic
No off target data available for this crispr